EMAIL THIS PAGE TO A FRIEND

TMEM31

transmembrane protein 31

UniProtKB ID: Q5JXX7, Q8NHR4
Gene ID:
domestic cat(101098362) transmembrane protein 31
cow(100298086) transmembrane protein 31
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182541 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182541 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116560 predicted 372
2 SASI_Hs01_00116561 predicted 382
3 SASI_Hs01_00116562 predicted 377
4 SASI_Hs01_00116563 predicted 363
5 SASI_Hs01_00116564 predicted 367
6 SASI_Hs01_00116565 predicted 390
7 SASI_Hs01_00116566 predicted 382
8 SASI_Hs01_00116567 predicted 385
9 SASI_Hs01_00116568 predicted 380
10 SASI_Hs01_00116569 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182541
VALIDATED
TMEM31 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 31
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182541.1-582s1c1
Sequence:CCGGCTCCACCCTCTACTTCTACAACTCGAGTTGTAGAAGTAGAGGGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182541.1-250s1c1
Sequence:CCGGGCACCCAATGAAGATCAAGAACTCGAGTTCTTGATCTTCATTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182541.1-503s1c1
Sequence:CCGGCCTTCCATGACATATCCCATTCTCGAGAATGGGATATGTCATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182541.1-271s1c1
Sequence:CCGGGAAGAAATCCAACAGTCAGAACTCGAGTTCTGACTGTTGGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182541.1-344s1c1
Sequence:CCGGGATGTCGATTGCCTTCACGTACTCGAGTACGTGAAGGCAATCGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182541.1-236s1c1
Sequence:CCGGCCAACAACTCTAATGCACCCACTCGAGTGGGTGCATTAGAGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182541.1-359s1c1
Sequence:CCGGCACGTAGGACACCTACAACATCTCGAGATGTTGTAGGTGTCCTACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182541.2-415s21c1
Sequence:CCGGCGTGGCCTACTGAGTGGATTTCTCGAGAAATCCACTCAGTAGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182541.2-382s21c1
Sequence:CCGGGCGACAGAACGATCAACCTTCCTCGAGGAAGGTTGATCGTTCTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182541.2-476s21c1
Sequence:CCGGTGAATTTCTTCTGGTGTTTAACTCGAGTTAAACACCAGAAGAAATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182541
VALIDATED
TMEM31 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 31
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182541.1-582s1c1
Sequence:CCGGCTCCACCCTCTACTTCTACAACTCGAGTTGTAGAAGTAGAGGGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182541.1-250s1c1
Sequence:CCGGGCACCCAATGAAGATCAAGAACTCGAGTTCTTGATCTTCATTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182541.1-503s1c1
Sequence:CCGGCCTTCCATGACATATCCCATTCTCGAGAATGGGATATGTCATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182541.1-271s1c1
Sequence:CCGGGAAGAAATCCAACAGTCAGAACTCGAGTTCTGACTGTTGGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182541.1-344s1c1
Sequence:CCGGGATGTCGATTGCCTTCACGTACTCGAGTACGTGAAGGCAATCGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182541.1-236s1c1
Sequence:CCGGCCAACAACTCTAATGCACCCACTCGAGTGGGTGCATTAGAGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182541.1-359s1c1
Sequence:CCGGCACGTAGGACACCTACAACATCTCGAGATGTTGTAGGTGTCCTACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182541.2-415s21c1
Sequence:CCGGCGTGGCCTACTGAGTGGATTTCTCGAGAAATCCACTCAGTAGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182541.2-382s21c1
Sequence:CCGGGCGACAGAACGATCAACCTTCCTCGAGGAAGGTTGATCGTTCTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182541.2-476s21c1
Sequence:CCGGTGAATTTCTTCTGGTGTTTAACTCGAGTTAAACACCAGAAGAAATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182541
VALIDATED
TMEM31 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 31
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182541.1-582s1c1
Sequence:CCGGCTCCACCCTCTACTTCTACAACTCGAGTTGTAGAAGTAGAGGGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182541.1-250s1c1
Sequence:CCGGGCACCCAATGAAGATCAAGAACTCGAGTTCTTGATCTTCATTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182541.1-503s1c1
Sequence:CCGGCCTTCCATGACATATCCCATTCTCGAGAATGGGATATGTCATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182541.1-271s1c1
Sequence:CCGGGAAGAAATCCAACAGTCAGAACTCGAGTTCTGACTGTTGGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182541.1-344s1c1
Sequence:CCGGGATGTCGATTGCCTTCACGTACTCGAGTACGTGAAGGCAATCGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182541.1-236s1c1
Sequence:CCGGCCAACAACTCTAATGCACCCACTCGAGTGGGTGCATTAGAGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_182541.1-359s1c1
Sequence:CCGGCACGTAGGACACCTACAACATCTCGAGATGTTGTAGGTGTCCTACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182541.2-415s21c1
Sequence:CCGGCGTGGCCTACTGAGTGGATTTCTCGAGAAATCCACTCAGTAGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182541.2-382s21c1
Sequence:CCGGGCGACAGAACGATCAACCTTCCTCGAGGAAGGTTGATCGTTCTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182541.2-476s21c1
Sequence:CCGGTGAATTTCTTCTGGTGTTTAACTCGAGTTAAACACCAGAAGAAATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks