EMAIL THIS PAGE TO A FRIEND

TMEM33

transmembrane protein 33

Synonyms: 1600019D15Rik SHINC3
UniProtKB ID: P57088, B3KSS8, Q9H953
Gene ID:
Mouse(67878) transmembrane protein 33
Rat(59303) transmembrane protein 33
cow(614879) transmembrane protein 33
sheep(101118275) transmembrane protein 33
domestic guinea pig(100716173) transmembrane protein 33
naked mole-rat(101698483) transmembrane protein 33
Zebrafish(327214) transmembrane protein 33
chicken(422779) transmembrane protein 33
dog(612937) transmembrane protein 33
domestic cat(101092851) transmembrane protein 33
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018126 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018126 Rosetta Predictions human pricing
NM_001034198 Rosetta Predictions rat pricing
NM_021671 Rosetta Predictions rat pricing
NM_028975 Rosetta Predictions mouse pricing
NM_030108 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209910 predicted 967
2 SASI_Hs01_00209911 predicted 505
3 SASI_Hs01_00209912 predicted 616
4 SASI_Hs01_00209914 predicted 891
5 SASI_Hs01_00209915 predicted 576
6 SASI_Hs01_00209916 predicted 386
7 SASI_Hs01_00209917 predicted 656
8 SASI_Hs02_00351337 predicted 1109
9 SASI_Hs01_00209918 predicted 1014
10 SASI_Hs01_00209919 predicted 910
11 SASI_Hs01_00209913 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204023 predicted 509
2 SASI_Rn02_00204024 predicted 225
3 SASI_Rn02_00204025 predicted 249
4 SASI_Rn02_00204026 predicted 217
5 SASI_Rn02_00204027 predicted 197
6 SASI_Rn02_00204028 predicted 427
7 SASI_Rn02_00204029 predicted 429
8 SASI_Rn02_00204030 predicted 395
9 SASI_Rn02_00204031 predicted 262
10 SASI_Rn02_00204032 predicted 209
11 SASI_Rn01_00069563 predicted 921
12 SASI_Rn01_00069564 predicted 794
13 SASI_Rn01_00069565 predicted 719
14 SASI_Rn01_00069566 predicted 598
15 SASI_Rn01_00069567 predicted 661
16 SASI_Rn01_00069568 predicted 904
17 SASI_Rn01_00069569 predicted 928
18 SASI_Rn01_00069570 predicted 879
19 SASI_Rn01_00069571 predicted 612
20 SASI_Rn01_00069572 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262683 predicted 511
2 SASI_Rn02_00262684 predicted 229
3 SASI_Rn02_00262685 predicted 249
4 SASI_Rn02_00262686 predicted 214
5 SASI_Rn02_00262687 predicted 202
6 SASI_Rn02_00262688 predicted 423
7 SASI_Rn02_00262689 predicted 436
8 SASI_Rn02_00262690 predicted 400
9 SASI_Rn02_00262691 predicted 255
10 SASI_Rn02_00262692 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334703 predicted 653
2 SASI_Mm01_00137780 predicted 574
3 SASI_Mm01_00137781 predicted 480
4 SASI_Mm01_00137782 predicted 219
5 SASI_Mm01_00137783 predicted 490
6 SASI_Mm01_00137784 predicted 567
7 SASI_Mm01_00137785 predicted 541
8 SASI_Mm01_00137786 predicted 641
9 SASI_Mm01_00137787 predicted 597
10 SASI_Mm01_00137788 predicted 280
11 SASI_Mm01_00137779 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030108 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336494 predicted 650
2 SASI_Mm01_00161427 predicted 577
3 SASI_Mm01_00161428 predicted 484
4 SASI_Mm01_00161429 predicted 220
5 SASI_Mm01_00161430 predicted 498
6 SASI_Mm01_00161431 predicted 568
7 SASI_Mm01_00161432 predicted 539
8 SASI_Mm01_00161433 predicted 646
9 SASI_Mm01_00161434 predicted 598
10 SASI_Mm01_00161435 predicted 271
11 SASI_Mm01_00161426 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018126
VALIDATED
TMEM33 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 33
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018126.2-792s21c1
Sequence:CCGGAGATCTGTCTTGGACAAATTACTCGAGTAATTTGTCCAAGACAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018126.2-1093s21c1
Sequence:CCGGCACCAACAGTTCCATAGTTTACTCGAGTAAACTATGGAACTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018126.2-1444s21c1
Sequence:CCGGCTAATTGGTAACCTGAGTTTACTCGAGTAAACTCAGGTTACCAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018126.1-608s1c1
Sequence:CCGGGCTGCCACTACCTGTTGTATTCTCGAGAATACAACAGGTAGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018126.1-923s1c1
Sequence:CCGGCGTCTCGAAGAAACCCATATTCTCGAGAATATGGGTTTCTTCGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018126.1-1803s1c1
Sequence:CCGGCCATTGAGAAACATTTCTCAACTCGAGTTGAGAAATGTTTCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018126.1-935s1c1
Sequence:CCGGACCCATATTGTCGGACCTTATCTCGAGATAAGGTCCGACAATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018126.1-378s1c1
Sequence:CCGGGCAATTCATGATGACCAATAACTCGAGTTATTGGTCATCATGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018126
VALIDATED
TMEM33 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 33
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018126.2-792s21c1
Sequence:CCGGAGATCTGTCTTGGACAAATTACTCGAGTAATTTGTCCAAGACAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018126.2-1093s21c1
Sequence:CCGGCACCAACAGTTCCATAGTTTACTCGAGTAAACTATGGAACTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018126.2-1444s21c1
Sequence:CCGGCTAATTGGTAACCTGAGTTTACTCGAGTAAACTCAGGTTACCAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018126.1-608s1c1
Sequence:CCGGGCTGCCACTACCTGTTGTATTCTCGAGAATACAACAGGTAGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018126.1-923s1c1
Sequence:CCGGCGTCTCGAAGAAACCCATATTCTCGAGAATATGGGTTTCTTCGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018126.1-1803s1c1
Sequence:CCGGCCATTGAGAAACATTTCTCAACTCGAGTTGAGAAATGTTTCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018126.1-935s1c1
Sequence:CCGGACCCATATTGTCGGACCTTATCTCGAGATAAGGTCCGACAATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018126.1-378s1c1
Sequence:CCGGGCAATTCATGATGACCAATAACTCGAGTTATTGGTCATCATGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018126
VALIDATED
TMEM33 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 33
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018126.2-792s21c1
Sequence:CCGGAGATCTGTCTTGGACAAATTACTCGAGTAATTTGTCCAAGACAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018126.2-1093s21c1
Sequence:CCGGCACCAACAGTTCCATAGTTTACTCGAGTAAACTATGGAACTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018126.2-1444s21c1
Sequence:CCGGCTAATTGGTAACCTGAGTTTACTCGAGTAAACTCAGGTTACCAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018126.1-608s1c1
Sequence:CCGGGCTGCCACTACCTGTTGTATTCTCGAGAATACAACAGGTAGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018126.1-923s1c1
Sequence:CCGGCGTCTCGAAGAAACCCATATTCTCGAGAATATGGGTTTCTTCGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018126.1-1803s1c1
Sequence:CCGGCCATTGAGAAACATTTCTCAACTCGAGTTGAGAAATGTTTCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018126.1-935s1c1
Sequence:CCGGACCCATATTGTCGGACCTTATCTCGAGATAAGGTCCGACAATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018126.1-378s1c1
Sequence:CCGGGCAATTCATGATGACCAATAACTCGAGTTATTGGTCATCATGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028975
TMEM33 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 33
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028975.3-390s21c1
Sequence:CCGGGCATCAGAGATTACCTCACTTCTCGAGAAGTGAGGTAATCTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028975.3-5224s1c1
Sequence:CCGGCTAACGTTGTTCATAACATTTCTCGAGAAATGTTATGAACAACGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215397    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028975.3-4381s1c1
Sequence:CCGGCTAGATAGAATCCGTTAAATTCTCGAGAATTTAACGGATTCTATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216557    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028975.3-3955s1c1
Sequence:CCGGGATTATGCTGTGCTACTTAAACTCGAGTTTAAGTAGCACAGCATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028975.3-649s21c1
Sequence:CCGGCTGAAATTCATCGCTTGTAATCTCGAGATTACAAGCGATGAATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028975.3-225s21c1
Sequence:CCGGGCAATTCATGATGACCAATAACTCGAGTTATTGGTCATCATGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028975.3-576s21c1
Sequence:CCGGCGCAAAGGGTTCAAATAGTTTCTCGAGAAACTATTTGAACCCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028975.2-470s1c1
Sequence:CCGGCCTACCCTGTCACAATGAGTACTCGAGTACTCATTGTGACAGGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-552s1c1
Sequence:CCGGCGCAAAGGGTTCAAATAGTTTCTCGAGAAACTATTTGAACCCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-366s1c1
Sequence:CCGGGCATCAGAGATTACCTCACTTCTCGAGAAGTGAGGTAATCTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028975.2-784s1c1
Sequence:CCGGGAACTGAGGATTGTGGTTGAACTCGAGTTCAACCACAATCCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-625s1c1
Sequence:CCGGCTGAAATTCATCGCTTGTAATCTCGAGATTACAAGCGATGAATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-201s1c1
Sequence:CCGGGCAATTCATGATGACCAATAACTCGAGTTATTGGTCATCATGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-553s1c1
Sequence:CCGGGCAAAGGGTTCAAATAGTTTACTCGAGTAAACTATTTGAACCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028975
TMEM33 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 33
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028975.3-390s21c1
Sequence:CCGGGCATCAGAGATTACCTCACTTCTCGAGAAGTGAGGTAATCTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028975.3-5224s1c1
Sequence:CCGGCTAACGTTGTTCATAACATTTCTCGAGAAATGTTATGAACAACGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215397    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028975.3-4381s1c1
Sequence:CCGGCTAGATAGAATCCGTTAAATTCTCGAGAATTTAACGGATTCTATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216557    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028975.3-3955s1c1
Sequence:CCGGGATTATGCTGTGCTACTTAAACTCGAGTTTAAGTAGCACAGCATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028975.3-649s21c1
Sequence:CCGGCTGAAATTCATCGCTTGTAATCTCGAGATTACAAGCGATGAATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028975.3-225s21c1
Sequence:CCGGGCAATTCATGATGACCAATAACTCGAGTTATTGGTCATCATGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028975.3-576s21c1
Sequence:CCGGCGCAAAGGGTTCAAATAGTTTCTCGAGAAACTATTTGAACCCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028975.2-470s1c1
Sequence:CCGGCCTACCCTGTCACAATGAGTACTCGAGTACTCATTGTGACAGGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-552s1c1
Sequence:CCGGCGCAAAGGGTTCAAATAGTTTCTCGAGAAACTATTTGAACCCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-366s1c1
Sequence:CCGGGCATCAGAGATTACCTCACTTCTCGAGAAGTGAGGTAATCTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028975.2-784s1c1
Sequence:CCGGGAACTGAGGATTGTGGTTGAACTCGAGTTCAACCACAATCCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-625s1c1
Sequence:CCGGCTGAAATTCATCGCTTGTAATCTCGAGATTACAAGCGATGAATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-201s1c1
Sequence:CCGGGCAATTCATGATGACCAATAACTCGAGTTATTGGTCATCATGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-553s1c1
Sequence:CCGGGCAAAGGGTTCAAATAGTTTACTCGAGTAAACTATTTGAACCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028975
TMEM33 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 33
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028975.3-390s21c1
Sequence:CCGGGCATCAGAGATTACCTCACTTCTCGAGAAGTGAGGTAATCTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028975.3-5224s1c1
Sequence:CCGGCTAACGTTGTTCATAACATTTCTCGAGAAATGTTATGAACAACGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215397    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028975.3-4381s1c1
Sequence:CCGGCTAGATAGAATCCGTTAAATTCTCGAGAATTTAACGGATTCTATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216557    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028975.3-3955s1c1
Sequence:CCGGGATTATGCTGTGCTACTTAAACTCGAGTTTAAGTAGCACAGCATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028975.3-649s21c1
Sequence:CCGGCTGAAATTCATCGCTTGTAATCTCGAGATTACAAGCGATGAATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028975.3-225s21c1
Sequence:CCGGGCAATTCATGATGACCAATAACTCGAGTTATTGGTCATCATGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028975.3-576s21c1
Sequence:CCGGCGCAAAGGGTTCAAATAGTTTCTCGAGAAACTATTTGAACCCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028975.2-470s1c1
Sequence:CCGGCCTACCCTGTCACAATGAGTACTCGAGTACTCATTGTGACAGGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-552s1c1
Sequence:CCGGCGCAAAGGGTTCAAATAGTTTCTCGAGAAACTATTTGAACCCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-366s1c1
Sequence:CCGGGCATCAGAGATTACCTCACTTCTCGAGAAGTGAGGTAATCTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028975.2-784s1c1
Sequence:CCGGGAACTGAGGATTGTGGTTGAACTCGAGTTCAACCACAATCCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-625s1c1
Sequence:CCGGCTGAAATTCATCGCTTGTAATCTCGAGATTACAAGCGATGAATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-201s1c1
Sequence:CCGGGCAATTCATGATGACCAATAACTCGAGTTATTGGTCATCATGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028975.2-553s1c1
Sequence:CCGGGCAAAGGGTTCAAATAGTTTACTCGAGTAAACTATTTGAACCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks