EMAIL THIS PAGE TO A FRIEND

TMEM35

transmembrane protein 35

UniProtKB ID: Q53FP2, Q9H7Y3
Gene ID:
Mouse(67564) transmembrane protein 35
Rat(308134) transmembrane protein 35
Zebrafish(791920) transmembrane protein 35
chicken(422194) transmembrane protein 35
dog(480983) transmembrane protein 35
domestic cat(101086632) transmembrane protein 35
naked mole-rat(101717673) transmembrane protein 35
domestic guinea pig(100720527) transmembrane protein 35
cow(533337) transmembrane protein 35
sheep(101104301) transmembrane protein 35
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021637 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026239 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026239 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026239 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021637 Rosetta Predictions human pricing
NM_001001799 Rosetta Predictions rat pricing
NM_026239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026324 predicted 397
2 SASI_Hs01_00026325 predicted 569
3 SASI_Hs01_00026326 predicted 224
4 SASI_Hs01_00026327 predicted 496
5 SASI_Hs01_00026328 predicted 525
6 SASI_Hs01_00026329 predicted 235
7 SASI_Hs01_00026330 predicted 320
8 SASI_Hs01_00026331 predicted 447
9 SASI_Hs01_00026332 predicted 387
10 SASI_Hs02_00354997 predicted 550
11 SASI_Hs01_00026333 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00197944 predicted 502
2 SASI_Rn01_00120923 predicted 444
3 SASI_Rn01_00120926 predicted 1259
4 SASI_Rn01_00120927 predicted 1227
5 SASI_Rn01_00120928 predicted 1251
6 SASI_Rn01_00120929 predicted 1158
7 SASI_Rn01_00120930 predicted 391
8 SASI_Rn01_00120931 predicted 470
9 SASI_Rn01_00120932 predicted 1132
10 SASI_Rn02_00197945 predicted 517
11 SASI_Rn01_00120924 predicted 1204
12 SASI_Rn01_00120925 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120565 predicted 1261
2 SASI_Mm01_00120566 predicted 378
3 SASI_Mm02_00329921 predicted 507
4 SASI_Mm02_00329922 predicted 1183
5 SASI_Mm01_00120568 predicted 1213
6 SASI_Mm01_00120569 predicted 1218
7 SASI_Mm01_00120570 predicted 301
8 SASI_Mm01_00120571 predicted 517
9 SASI_Mm01_00120573 predicted 1164
10 SASI_Mm01_00120574 predicted 1206
11 SASI_Mm01_00120567 predicted 1177
12 SASI_Mm01_00120572 predicted 399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021637
TMEM35 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 35
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021637.1-249s1c1
Sequence:CCGGGAAACGTGCTTACAAGAGCTACTCGAGTAGCTCTTGTAAGCACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021637.1-1659s1c1
Sequence:CCGGCCAAACAGATTCACTACTCTTCTCGAGAAGAGTAGTGAATCTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021637.1-386s1c1
Sequence:CCGGCCAAAGATGTGGCCAACTTCTCTCGAGAGAAGTTGGCCACATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021637.1-1263s1c1
Sequence:CCGGGCTCTAGTCCAACAGTTGTTTCTCGAGAAACAACTGTTGGACTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021637.1-306s1c1
Sequence:CCGGCAATTCCATTCTCCTCCGAAACTCGAGTTTCGGAGGAGAATGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021637.1-253s1c1
Sequence:CCGGCGTGCTTACAAGAGCTATGTTCTCGAGAACATAGCTCTTGTAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021637.2-499s21c1
Sequence:CCGCTACGCCCATGCTCTGGTGTTTCTCGAGAAACACCAGAGCATGGGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021637.2-1062s21c1
Sequence:CCCGAGGCGCTGATCTTGAACTAATCTCGAGATTAGTTCAAGATCAGCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021637
TMEM35 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 35
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021637.1-249s1c1
Sequence:CCGGGAAACGTGCTTACAAGAGCTACTCGAGTAGCTCTTGTAAGCACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021637.1-1659s1c1
Sequence:CCGGCCAAACAGATTCACTACTCTTCTCGAGAAGAGTAGTGAATCTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021637.1-386s1c1
Sequence:CCGGCCAAAGATGTGGCCAACTTCTCTCGAGAGAAGTTGGCCACATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021637.1-1263s1c1
Sequence:CCGGGCTCTAGTCCAACAGTTGTTTCTCGAGAAACAACTGTTGGACTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021637.1-306s1c1
Sequence:CCGGCAATTCCATTCTCCTCCGAAACTCGAGTTTCGGAGGAGAATGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021637.1-253s1c1
Sequence:CCGGCGTGCTTACAAGAGCTATGTTCTCGAGAACATAGCTCTTGTAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021637.2-499s21c1
Sequence:CCGCTACGCCCATGCTCTGGTGTTTCTCGAGAAACACCAGAGCATGGGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021637.2-1062s21c1
Sequence:CCCGAGGCGCTGATCTTGAACTAATCTCGAGATTAGTTCAAGATCAGCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021637
TMEM35 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 35
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021637.1-249s1c1
Sequence:CCGGGAAACGTGCTTACAAGAGCTACTCGAGTAGCTCTTGTAAGCACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021637.1-1659s1c1
Sequence:CCGGCCAAACAGATTCACTACTCTTCTCGAGAAGAGTAGTGAATCTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021637.1-386s1c1
Sequence:CCGGCCAAAGATGTGGCCAACTTCTCTCGAGAGAAGTTGGCCACATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021637.1-1263s1c1
Sequence:CCGGGCTCTAGTCCAACAGTTGTTTCTCGAGAAACAACTGTTGGACTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021637.1-306s1c1
Sequence:CCGGCAATTCCATTCTCCTCCGAAACTCGAGTTTCGGAGGAGAATGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021637.1-253s1c1
Sequence:CCGGCGTGCTTACAAGAGCTATGTTCTCGAGAACATAGCTCTTGTAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021637.2-499s21c1
Sequence:CCGCTACGCCCATGCTCTGGTGTTTCTCGAGAAACACCAGAGCATGGGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021637.2-1062s21c1
Sequence:CCCGAGGCGCTGATCTTGAACTAATCTCGAGATTAGTTCAAGATCAGCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026239
TMEM35 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 35
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026239.2-1580s1c1
Sequence:CCGGCCACCCAACTTTGCTAAAGTTCTCGAGAACTTTAGCAAAGTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026239.2-396s1c1
Sequence:CCGGCAGTGAAATGAAACGTGCTTACTCGAGTAAGCACGTTTCATTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026239.2-395s1c1
Sequence:CCGGACAGTGAAATGAAACGTGCTTCTCGAGAAGCACGTTTCATTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026239.2-738s1c1
Sequence:CCGGGCAACCATCCTTGTATGAGAACTCGAGTTCTCATACAAGGATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026239.2-409s1c1
Sequence:CCGGCGTGCTTACAAGAGCTACGTTCTCGAGAACGTAGCTCTTGTAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026239
TMEM35 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 35
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026239.2-1580s1c1
Sequence:CCGGCCACCCAACTTTGCTAAAGTTCTCGAGAACTTTAGCAAAGTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026239.2-396s1c1
Sequence:CCGGCAGTGAAATGAAACGTGCTTACTCGAGTAAGCACGTTTCATTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026239.2-395s1c1
Sequence:CCGGACAGTGAAATGAAACGTGCTTCTCGAGAAGCACGTTTCATTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026239.2-738s1c1
Sequence:CCGGGCAACCATCCTTGTATGAGAACTCGAGTTCTCATACAAGGATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026239.2-409s1c1
Sequence:CCGGCGTGCTTACAAGAGCTACGTTCTCGAGAACGTAGCTCTTGTAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026239
TMEM35 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 35
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026239.2-1580s1c1
Sequence:CCGGCCACCCAACTTTGCTAAAGTTCTCGAGAACTTTAGCAAAGTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026239.2-396s1c1
Sequence:CCGGCAGTGAAATGAAACGTGCTTACTCGAGTAAGCACGTTTCATTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026239.2-395s1c1
Sequence:CCGGACAGTGAAATGAAACGTGCTTCTCGAGAAGCACGTTTCATTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026239.2-738s1c1
Sequence:CCGGGCAACCATCCTTGTATGAGAACTCGAGTTCTCATACAAGGATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026239.2-409s1c1
Sequence:CCGGCGTGCTTACAAGAGCTACGTTCTCGAGAACGTAGCTCTTGTAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks