EMAIL THIS PAGE TO A FRIEND

TMEM37

transmembrane protein 37

Synonyms: PR PR1
UniProtKB ID: Q8WXS4
Gene ID:
Mouse(170706) transmembrane protein 37
Rat(245953) transmembrane protein 37
cow(613815) transmembrane protein 37
sheep(101111860) transmembrane protein 37
domestic guinea pig(100717605) transmembrane protein 37
naked mole-rat(101703290) transmembrane protein 37
Zebrafish(406453) transmembrane protein 37
chicken(770956) transmembrane protein 37
domestic cat(101085394) transmembrane protein 37
dog(610386) transmembrane protein 37
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA053794 Anti-TMEM37 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_183240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183240 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183240 Rosetta Predictions human pricing
NM_139095 Rosetta Predictions rat pricing
NM_019432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371239 predicted 1102
2 SASI_Hs02_00371240 predicted 591
3 SASI_Hs02_00371241 predicted 600
4 SASI_Hs02_00371242 predicted 554
5 SASI_Hs02_00371243 predicted 487
6 SASI_Hs02_00371244 predicted 630
7 SASI_Hs02_00371245 predicted 1064
8 SASI_Hs02_00371246 predicted 553
9 SASI_Hs02_00371247 predicted 1047
10 SASI_Hs02_00371248 predicted 1031
11 SASI_Hs01_00105822 predicted 202
12 SASI_Hs01_00105823 predicted 208
13 SASI_Hs01_00105824 predicted 197
14 SASI_Hs01_00105825 predicted 267
15 SASI_Hs01_00105826 predicted 282
16 SASI_Hs01_00105827 predicted 214
17 SASI_Hs01_00105828 predicted 209
18 SASI_Hs01_00105829 predicted 258
19 SASI_Hs01_00105830 predicted 219
20 SASI_Hs01_00105831 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069663 predicted 324
2 SASI_Rn02_00268464 predicted 389
3 SASI_Rn01_00069664 predicted 281
4 SASI_Rn01_00069665 predicted 370
5 SASI_Rn01_00069666 predicted 191
6 SASI_Rn01_00069667 predicted 319
7 SASI_Rn01_00069668 predicted 200
8 SASI_Rn01_00069670 predicted 351
9 SASI_Rn01_00069671 predicted 332
10 SASI_Rn01_00069672 predicted 217
11 SASI_Rn01_00069669 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183560 predicted 653
2 SASI_Mm01_00183561 predicted 724
3 SASI_Mm01_00183562 predicted 358
4 SASI_Mm01_00183563 predicted 661
5 SASI_Mm01_00183564 predicted 692
6 SASI_Mm01_00183565 predicted 212
7 SASI_Mm01_00183566 predicted 641
8 SASI_Mm01_00183567 predicted 440
9 SASI_Mm01_00183568 predicted 528
10 SASI_Mm02_00324368 predicted 729
11 SASI_Mm01_00183569 predicted 541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019432
TMEM37 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 37
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019432.2-831s21c1
Sequence:CCGGGATAGGTTAGTCATGCTATTACTCGAGTAATAGCATGACTAACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019432.2-442s21c1
Sequence:CCGGCTCCTCCTGGTTGCCTTTATCCTCGAGGATAAAGGCAACCAGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019432.2-643s21c1
Sequence:CCGGGCTTACAGAAAGCGAGGTTATCTCGAGATAACCTCGCTTTCTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019432.2-365s21c1
Sequence:CCGGTCGGCTTGGAGATGCTCATTGCTCGAGCAATGAGCATCTCCAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019432.2-682s21c1
Sequence:CCGGTAGGACCTCTGGCTGAGATTGCTCGAGCAATCTCAGCCAGAGGTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019432.2-696s1c1
Sequence:CCGGGAGATTGAATAGGACAACCAACTCGAGTTGGTTGTCCTATTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019432.2-105s1c1
Sequence:CCGGGTCTTTCTTTGAGTCCTTCATCTCGAGATGAAGGACTCAAAGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019432
TMEM37 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 37
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019432.2-831s21c1
Sequence:CCGGGATAGGTTAGTCATGCTATTACTCGAGTAATAGCATGACTAACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019432.2-442s21c1
Sequence:CCGGCTCCTCCTGGTTGCCTTTATCCTCGAGGATAAAGGCAACCAGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019432.2-643s21c1
Sequence:CCGGGCTTACAGAAAGCGAGGTTATCTCGAGATAACCTCGCTTTCTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019432.2-365s21c1
Sequence:CCGGTCGGCTTGGAGATGCTCATTGCTCGAGCAATGAGCATCTCCAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019432.2-682s21c1
Sequence:CCGGTAGGACCTCTGGCTGAGATTGCTCGAGCAATCTCAGCCAGAGGTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019432.2-696s1c1
Sequence:CCGGGAGATTGAATAGGACAACCAACTCGAGTTGGTTGTCCTATTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019432.2-105s1c1
Sequence:CCGGGTCTTTCTTTGAGTCCTTCATCTCGAGATGAAGGACTCAAAGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019432
TMEM37 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 37
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019432.2-831s21c1
Sequence:CCGGGATAGGTTAGTCATGCTATTACTCGAGTAATAGCATGACTAACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019432.2-442s21c1
Sequence:CCGGCTCCTCCTGGTTGCCTTTATCCTCGAGGATAAAGGCAACCAGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019432.2-643s21c1
Sequence:CCGGGCTTACAGAAAGCGAGGTTATCTCGAGATAACCTCGCTTTCTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019432.2-365s21c1
Sequence:CCGGTCGGCTTGGAGATGCTCATTGCTCGAGCAATGAGCATCTCCAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019432.2-682s21c1
Sequence:CCGGTAGGACCTCTGGCTGAGATTGCTCGAGCAATCTCAGCCAGAGGTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019432.2-696s1c1
Sequence:CCGGGAGATTGAATAGGACAACCAACTCGAGTTGGTTGTCCTATTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019432.2-105s1c1
Sequence:CCGGGTCTTTCTTTGAGTCCTTCATCTCGAGATGAAGGACTCAAAGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183240
VALIDATED
TMEM37 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 37
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_183240.2-597s21c1
Sequence:CCGGCCTGGGAATGACCGTGGAAATCTCGAGATTTCCACGGTCATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183240.2-150s21c1
Sequence:CCGGTCCTGTCCTCGGTCTCCATTTCTCGAGAAATGGAGACCGAGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183240.2-419s21c1
Sequence:CCGGATCCTCCTCCTGGTGTCTTTCCTCGAGGAAAGACACCAGGAGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183240.2-497s21c1
Sequence:CCGGCTCATCGGCTTCACCCTAATGCTCGAGCATTAGGGTGAAGCCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183240.2-1307s21c1
Sequence:CCGGCCTATCAGAACCCTACCTTAACTCGAGTTAAGGTAGGGTTCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183240
VALIDATED
TMEM37 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 37
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_183240.2-597s21c1
Sequence:CCGGCCTGGGAATGACCGTGGAAATCTCGAGATTTCCACGGTCATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183240.2-150s21c1
Sequence:CCGGTCCTGTCCTCGGTCTCCATTTCTCGAGAAATGGAGACCGAGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183240.2-419s21c1
Sequence:CCGGATCCTCCTCCTGGTGTCTTTCCTCGAGGAAAGACACCAGGAGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183240.2-497s21c1
Sequence:CCGGCTCATCGGCTTCACCCTAATGCTCGAGCATTAGGGTGAAGCCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183240.2-1307s21c1
Sequence:CCGGCCTATCAGAACCCTACCTTAACTCGAGTTAAGGTAGGGTTCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183240
VALIDATED
TMEM37 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 37
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_183240.2-597s21c1
Sequence:CCGGCCTGGGAATGACCGTGGAAATCTCGAGATTTCCACGGTCATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183240.2-150s21c1
Sequence:CCGGTCCTGTCCTCGGTCTCCATTTCTCGAGAAATGGAGACCGAGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183240.2-419s21c1
Sequence:CCGGATCCTCCTCCTGGTGTCTTTCCTCGAGGAAAGACACCAGGAGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183240.2-497s21c1
Sequence:CCGGCTCATCGGCTTCACCCTAATGCTCGAGCATTAGGGTGAAGCCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183240.2-1307s21c1
Sequence:CCGGCCTATCAGAACCCTACCTTAACTCGAGTTAAGGTAGGGTTCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks