EMAIL THIS PAGE TO A FRIEND

TMEM38A

transmembrane protein 38A

Synonyms: TRIC-A TRICA
UniProtKB ID: Q9H6F2, A8K9P9
Gene ID:
Mouse(74166) transmembrane protein 38A
Rat(306327) transmembrane protein 38a
Zebrafish(393874) transmembrane protein 38A
domestic cat(101080515) transmembrane protein 38A
dog(610207) transmembrane protein 38A
chicken(771253) transmembrane protein 38A
naked mole-rat(101699008) transmembrane protein 38A
domestic guinea pig(100731083) transmembrane protein 38A
cow(532775) transmembrane protein 38A
sheep(101115206) transmembrane protein 38A
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024074 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024074 Rosetta Predictions human pricing
NM_001100175 Rosetta Predictions rat pricing
NM_144534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133020 predicted 612
2 SASI_Hs01_00133021 predicted 355
3 SASI_Hs01_00133022 predicted 426
4 SASI_Hs01_00133023 predicted 318
5 SASI_Hs01_00133024 predicted 661
6 SASI_Hs01_00133025 predicted 563
7 SASI_Hs01_00133026 predicted 353
8 SASI_Hs01_00133027 predicted 620
9 SASI_Hs01_00133028 predicted 657
10 SASI_Hs01_00133029 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209834 predicted 862
2 SASI_Rn02_00209835 predicted 313
3 SASI_Rn02_00209836 predicted 603
4 SASI_Rn02_00209837 predicted 736
5 SASI_Rn02_00209838 predicted 614
6 SASI_Rn02_00209839 predicted 328
7 SASI_Rn02_00209840 predicted 275
8 SASI_Rn02_00209841 predicted 332
9 SASI_Rn02_00209842 predicted 997
10 SASI_Rn02_00209843 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141200 predicted 1080
2 SASI_Mm01_00141201 predicted 1195
3 SASI_Mm01_00141203 predicted 530
4 SASI_Mm01_00141204 predicted 1207
5 SASI_Mm01_00141205 predicted 1200
6 SASI_Mm01_00141206 predicted 1207
7 SASI_Mm02_00340066 predicted 933
8 SASI_Mm01_00141207 predicted 939
9 SASI_Mm01_00141208 predicted 694
10 SASI_Mm01_00141209 predicted 1205
11 SASI_Mm01_00141202 predicted 1072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024074
TMEM38A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 38A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024074.1-1093s1c1
Sequence:CCGGCCATCTGCAAATCAGGGTCATCTCGAGATGACCCTGATTTGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024074.1-403s1c1
Sequence:CCGGCTTCTACAAGTGTGTCTGCTTCTCGAGAAGCAGACACACTTGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024074.1-961s1c1
Sequence:CCGGCAGGAAGAAGAAGGCCAAGAACTCGAGTTCTTGGCCTTCTTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024074.1-1259s1c1
Sequence:CCGGGCTCCAGTCAAGAATGTCACTCTCGAGAGTGACATTCTTGACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024074.1-1278s1c1
Sequence:CCGGCTGGTTGGCATGATATTCTTACTCGAGTAAGAATATCATGCCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024074.1-271s21c1
Sequence:CCGGGCATTGCTTCGGGAGCTACATCTCGAGATGTAGCTCCCGAAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024074.1-750s21c1
Sequence:CCGGTGGTGTCCTGTAAGGTGTTTCCTCGAGGAAACACCTTACAGGACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024074
TMEM38A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 38A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024074.1-1093s1c1
Sequence:CCGGCCATCTGCAAATCAGGGTCATCTCGAGATGACCCTGATTTGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024074.1-403s1c1
Sequence:CCGGCTTCTACAAGTGTGTCTGCTTCTCGAGAAGCAGACACACTTGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024074.1-961s1c1
Sequence:CCGGCAGGAAGAAGAAGGCCAAGAACTCGAGTTCTTGGCCTTCTTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024074.1-1259s1c1
Sequence:CCGGGCTCCAGTCAAGAATGTCACTCTCGAGAGTGACATTCTTGACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024074.1-1278s1c1
Sequence:CCGGCTGGTTGGCATGATATTCTTACTCGAGTAAGAATATCATGCCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024074.1-271s21c1
Sequence:CCGGGCATTGCTTCGGGAGCTACATCTCGAGATGTAGCTCCCGAAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024074.1-750s21c1
Sequence:CCGGTGGTGTCCTGTAAGGTGTTTCCTCGAGGAAACACCTTACAGGACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024074
TMEM38A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 38A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024074.1-1093s1c1
Sequence:CCGGCCATCTGCAAATCAGGGTCATCTCGAGATGACCCTGATTTGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024074.1-403s1c1
Sequence:CCGGCTTCTACAAGTGTGTCTGCTTCTCGAGAAGCAGACACACTTGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024074.1-961s1c1
Sequence:CCGGCAGGAAGAAGAAGGCCAAGAACTCGAGTTCTTGGCCTTCTTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024074.1-1259s1c1
Sequence:CCGGGCTCCAGTCAAGAATGTCACTCTCGAGAGTGACATTCTTGACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024074.1-1278s1c1
Sequence:CCGGCTGGTTGGCATGATATTCTTACTCGAGTAAGAATATCATGCCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024074.1-271s21c1
Sequence:CCGGGCATTGCTTCGGGAGCTACATCTCGAGATGTAGCTCCCGAAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024074.1-750s21c1
Sequence:CCGGTGGTGTCCTGTAAGGTGTTTCCTCGAGGAAACACCTTACAGGACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144534
TMEM38A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 38A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144534.1-651s1c1
Sequence:CCGGCCATGTTTATGGTGTCATGTACTCGAGTACATGACACCATAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144534.1-229s1c1
Sequence:CCGGCATCATTGACTACTTCAGCAACTCGAGTTGCTGAAGTAGTCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144534.1-313s1c1
Sequence:CCGGCTTCTACAAGTGTGTCTGCTTCTCGAGAAGCAGACACACTTGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144534.1-520s1c1
Sequence:CCGGGAAGCCAGAAACTAATGAGATCTCGAGATCTCATTAGTTTCTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144534.1-1384s1c1
Sequence:CCGGGCCTTCTGTTTCTGTTCTGTACTCGAGTACAGAACAGAAACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144534
TMEM38A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 38A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144534.1-651s1c1
Sequence:CCGGCCATGTTTATGGTGTCATGTACTCGAGTACATGACACCATAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144534.1-229s1c1
Sequence:CCGGCATCATTGACTACTTCAGCAACTCGAGTTGCTGAAGTAGTCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144534.1-313s1c1
Sequence:CCGGCTTCTACAAGTGTGTCTGCTTCTCGAGAAGCAGACACACTTGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144534.1-520s1c1
Sequence:CCGGGAAGCCAGAAACTAATGAGATCTCGAGATCTCATTAGTTTCTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144534.1-1384s1c1
Sequence:CCGGGCCTTCTGTTTCTGTTCTGTACTCGAGTACAGAACAGAAACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144534
TMEM38A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 38A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144534.1-651s1c1
Sequence:CCGGCCATGTTTATGGTGTCATGTACTCGAGTACATGACACCATAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144534.1-229s1c1
Sequence:CCGGCATCATTGACTACTTCAGCAACTCGAGTTGCTGAAGTAGTCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144534.1-313s1c1
Sequence:CCGGCTTCTACAAGTGTGTCTGCTTCTCGAGAAGCAGACACACTTGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144534.1-520s1c1
Sequence:CCGGGAAGCCAGAAACTAATGAGATCTCGAGATCTCATTAGTTTCTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144534.1-1384s1c1
Sequence:CCGGGCCTTCTGTTTCTGTTCTGTACTCGAGTACAGAACAGAAACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks