EMAIL THIS PAGE TO A FRIEND

TMEM38B

transmembrane protein 38B

Synonyms: C9orf87 D4Ertd89e OI14 TRIC-B TRICB bA219P18.1
UniProtKB ID: Q9NVV0, Q5JR63, Q5SVN5, Q5SVN6, Q5VTE2, Q6IA97
Gene ID:
Human(55151) Summary: This gene encodes an intracellular monovalent cation channel that functions in maintenance of intracellular calcium release. Mutations in this gene may be associated with autosomal recessive osteogenesis. [provided by RefSeq, Oct 2012]
Mouse(52076) transmembrane protein 38B
Rat(362521) transmembrane protein 38B
cow(615646) transmembrane protein 38B
sheep(101116958) transmembrane protein 38B
domestic guinea pig(100723272) transmembrane protein 38B
naked mole-rat(101700041) transmembrane protein 38B
Zebrafish(393145) transmembrane protein 38B
domestic cat(101086352) transmembrane protein 38B
dog(481654) transmembrane protein 38B
chicken(427305) transmembrane protein 38B
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028053 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028053 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028053 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018112 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058391 MISSION® esiRNA esiRNA human TMEM38B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018112 Rosetta Predictions human pricing
NM_001014191 Rosetta Predictions rat pricing
NM_028053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145873 predicted 653
2 SASI_Hs01_00145874 predicted 505
3 SASI_Hs01_00145875 predicted 259
4 SASI_Hs02_00351307 predicted 500
5 SASI_Hs01_00145876 predicted 468
6 SASI_Hs01_00145877 predicted 537
7 SASI_Hs02_00351308 predicted 729
8 SASI_Hs01_00145878 predicted 445
9 SASI_Hs01_00145880 predicted 789
10 SASI_Hs01_00145881 predicted 253
11 SASI_Hs01_00145879 predicted 361
12 SASI_Hs01_00145882 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038189 predicted 212
2 SASI_Rn01_00038190 predicted 255
3 SASI_Rn01_00038191 predicted 378
4 SASI_Rn02_00201696 predicted 930
5 SASI_Rn01_00038192 predicted 642
6 SASI_Rn01_00038193 predicted 675
7 SASI_Rn01_00038194 predicted 506
8 SASI_Rn01_00038195 predicted 978
9 SASI_Rn02_00201697 predicted 286
10 SASI_Rn01_00038196 predicted 287
11 SASI_Rn01_00038197 predicted 418
12 SASI_Rn01_00038198 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047654 predicted 346
2 SASI_Mm01_00047655 predicted 441
3 SASI_Mm01_00047656 predicted 392
4 SASI_Mm02_00333245 predicted 308
5 SASI_Mm01_00047657 predicted 452
6 SASI_Mm02_00333246 predicted 826
7 SASI_Mm01_00047658 predicted 269
8 SASI_Mm01_00047659 predicted 343
9 SASI_Mm01_00047661 predicted 347
10 SASI_Mm01_00047662 predicted 461
11 SASI_Mm01_00047660 predicted 438
12 SASI_Mm01_00047663 predicted 554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028053
VALIDATED
TMEM38B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 38B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028053.1-1098s21c1
Sequence:CCGGCGAGTGTATCATGTGAATTTACTCGAGTAAATTCACATGATACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028053.1-897s21c1
Sequence:CCGGGCTAAGAGACACGCCAAGAAACTCGAGTTTCTTGGCGTGTCTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028053.1-465s21c1
Sequence:CCGGGCCTGGATAGTCATGATAGTTCTCGAGAACTATCATGACTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028053.1-303s21c1
Sequence:CCGGGCATCTTCAATCTGGTATATTCTCGAGAATATACCAGATTGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028053.1-695s21c1
Sequence:CCGGCGTGACCATAAAGGTAACCATCTCGAGATGGTTACCTTTATGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028053.1-897s1c1
Sequence:CCGGGCTAAGAGACACGCCAAGAAACTCGAGTTTCTTGGCGTGTCTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028053.1-465s1c1
Sequence:CCGGGCCTGGATAGTCATGATAGTTCTCGAGAACTATCATGACTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028053.1-1098s1c1
Sequence:CCGGCGAGTGTATCATGTGAATTTACTCGAGTAAATTCACATGATACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028053.1-695s1c1
Sequence:CCGGCGTGACCATAAAGGTAACCATCTCGAGATGGTTACCTTTATGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028053.1-303s1c1
Sequence:CCGGGCATCTTCAATCTGGTATATTCTCGAGAATATACCAGATTGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028053
VALIDATED
TMEM38B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 38B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028053.1-1098s21c1
Sequence:CCGGCGAGTGTATCATGTGAATTTACTCGAGTAAATTCACATGATACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028053.1-897s21c1
Sequence:CCGGGCTAAGAGACACGCCAAGAAACTCGAGTTTCTTGGCGTGTCTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028053.1-465s21c1
Sequence:CCGGGCCTGGATAGTCATGATAGTTCTCGAGAACTATCATGACTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028053.1-303s21c1
Sequence:CCGGGCATCTTCAATCTGGTATATTCTCGAGAATATACCAGATTGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028053.1-695s21c1
Sequence:CCGGCGTGACCATAAAGGTAACCATCTCGAGATGGTTACCTTTATGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028053.1-897s1c1
Sequence:CCGGGCTAAGAGACACGCCAAGAAACTCGAGTTTCTTGGCGTGTCTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028053.1-465s1c1
Sequence:CCGGGCCTGGATAGTCATGATAGTTCTCGAGAACTATCATGACTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028053.1-1098s1c1
Sequence:CCGGCGAGTGTATCATGTGAATTTACTCGAGTAAATTCACATGATACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028053.1-695s1c1
Sequence:CCGGCGTGACCATAAAGGTAACCATCTCGAGATGGTTACCTTTATGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028053.1-303s1c1
Sequence:CCGGGCATCTTCAATCTGGTATATTCTCGAGAATATACCAGATTGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028053
VALIDATED
TMEM38B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 38B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028053.1-1098s21c1
Sequence:CCGGCGAGTGTATCATGTGAATTTACTCGAGTAAATTCACATGATACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028053.1-897s21c1
Sequence:CCGGGCTAAGAGACACGCCAAGAAACTCGAGTTTCTTGGCGTGTCTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028053.1-465s21c1
Sequence:CCGGGCCTGGATAGTCATGATAGTTCTCGAGAACTATCATGACTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028053.1-303s21c1
Sequence:CCGGGCATCTTCAATCTGGTATATTCTCGAGAATATACCAGATTGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028053.1-695s21c1
Sequence:CCGGCGTGACCATAAAGGTAACCATCTCGAGATGGTTACCTTTATGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028053.1-897s1c1
Sequence:CCGGGCTAAGAGACACGCCAAGAAACTCGAGTTTCTTGGCGTGTCTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028053.1-465s1c1
Sequence:CCGGGCCTGGATAGTCATGATAGTTCTCGAGAACTATCATGACTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028053.1-1098s1c1
Sequence:CCGGCGAGTGTATCATGTGAATTTACTCGAGTAAATTCACATGATACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028053.1-695s1c1
Sequence:CCGGCGTGACCATAAAGGTAACCATCTCGAGATGGTTACCTTTATGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028053.1-303s1c1
Sequence:CCGGGCATCTTCAATCTGGTATATTCTCGAGAATATACCAGATTGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018112
VALIDATED
TMEM38B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 38B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018112.1-1105s21c1
Sequence:CCGGGAGGTGACAGAAAGAAAGAAACTCGAGTTTCTTTCTTTCTGTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018112.1-1174s21c1
Sequence:CCGGGTTACGAGTGTATCATGTGATCTCGAGATCACATGATACACTCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018112.1-938s21c1
Sequence:CCGGCGGTAGATGTTGCCTCAGATACTCGAGTATCTGAGGCAACATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018112.1-1190s21c1
Sequence:CCGGGTGATTATGCTTTACCGGTATCTCGAGATACCGGTAAAGCATAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018112.1-938s1c1
Sequence:CCGGCGGTAGATGTTGCCTCAGATACTCGAGTATCTGAGGCAACATCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018112.1-789s1c1
Sequence:CCGGGACTACACAGACTTCTACTATCTCGAGATAGTAGAAGTCTGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018112.1-1190s1c1
Sequence:CCGGGTGATTATGCTTTACCGGTATCTCGAGATACCGGTAAAGCATAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018112.1-252s1c1
Sequence:CCGGGAATCCTATTTCAAGCTGGTTCTCGAGAACCAGCTTGAAATAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018112.1-1105s1c1
Sequence:CCGGGAGGTGACAGAAAGAAAGAAACTCGAGTTTCTTTCTTTCTGTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018112.1-1174s1c1
Sequence:CCGGGTTACGAGTGTATCATGTGATCTCGAGATCACATGATACACTCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018112.1-892s1c1
Sequence:CCGGGAAGCAAAGTCACCTTCCAATCTCGAGATTGGAAGGTGACTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018112.1-1002s1c1
Sequence:CCGGGATGAGCTCTACAAGGCCAAACTCGAGTTTGGCCTTGTAGAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018112
VALIDATED
TMEM38B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 38B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018112.1-1105s21c1
Sequence:CCGGGAGGTGACAGAAAGAAAGAAACTCGAGTTTCTTTCTTTCTGTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018112.1-1174s21c1
Sequence:CCGGGTTACGAGTGTATCATGTGATCTCGAGATCACATGATACACTCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018112.1-938s21c1
Sequence:CCGGCGGTAGATGTTGCCTCAGATACTCGAGTATCTGAGGCAACATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018112.1-1190s21c1
Sequence:CCGGGTGATTATGCTTTACCGGTATCTCGAGATACCGGTAAAGCATAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018112.1-938s1c1
Sequence:CCGGCGGTAGATGTTGCCTCAGATACTCGAGTATCTGAGGCAACATCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018112.1-789s1c1
Sequence:CCGGGACTACACAGACTTCTACTATCTCGAGATAGTAGAAGTCTGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018112.1-1190s1c1
Sequence:CCGGGTGATTATGCTTTACCGGTATCTCGAGATACCGGTAAAGCATAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018112.1-252s1c1
Sequence:CCGGGAATCCTATTTCAAGCTGGTTCTCGAGAACCAGCTTGAAATAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018112.1-1105s1c1
Sequence:CCGGGAGGTGACAGAAAGAAAGAAACTCGAGTTTCTTTCTTTCTGTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018112.1-1174s1c1
Sequence:CCGGGTTACGAGTGTATCATGTGATCTCGAGATCACATGATACACTCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018112.1-892s1c1
Sequence:CCGGGAAGCAAAGTCACCTTCCAATCTCGAGATTGGAAGGTGACTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018112.1-1002s1c1
Sequence:CCGGGATGAGCTCTACAAGGCCAAACTCGAGTTTGGCCTTGTAGAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018112
VALIDATED
TMEM38B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 38B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018112.1-1105s21c1
Sequence:CCGGGAGGTGACAGAAAGAAAGAAACTCGAGTTTCTTTCTTTCTGTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018112.1-1174s21c1
Sequence:CCGGGTTACGAGTGTATCATGTGATCTCGAGATCACATGATACACTCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018112.1-938s21c1
Sequence:CCGGCGGTAGATGTTGCCTCAGATACTCGAGTATCTGAGGCAACATCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018112.1-1190s21c1
Sequence:CCGGGTGATTATGCTTTACCGGTATCTCGAGATACCGGTAAAGCATAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018112.1-938s1c1
Sequence:CCGGCGGTAGATGTTGCCTCAGATACTCGAGTATCTGAGGCAACATCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018112.1-789s1c1
Sequence:CCGGGACTACACAGACTTCTACTATCTCGAGATAGTAGAAGTCTGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018112.1-1190s1c1
Sequence:CCGGGTGATTATGCTTTACCGGTATCTCGAGATACCGGTAAAGCATAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018112.1-252s1c1
Sequence:CCGGGAATCCTATTTCAAGCTGGTTCTCGAGAACCAGCTTGAAATAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018112.1-1105s1c1
Sequence:CCGGGAGGTGACAGAAAGAAAGAAACTCGAGTTTCTTTCTTTCTGTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018112.1-1174s1c1
Sequence:CCGGGTTACGAGTGTATCATGTGATCTCGAGATCACATGATACACTCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018112.1-892s1c1
Sequence:CCGGGAAGCAAAGTCACCTTCCAATCTCGAGATTGGAAGGTGACTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018112.1-1002s1c1
Sequence:CCGGGATGAGCTCTACAAGGCCAAACTCGAGTTTGGCCTTGTAGAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks