EMAIL THIS PAGE TO A FRIEND

TMEM39A

transmembrane protein 39A

UniProtKB ID: Q9NV64, D3DN80, Q53FN4, Q53GI1, Q6PKB5
Gene ID:
Mouse(67846) transmembrane protein 39a
Rat(288092) transmembrane protein 39a
Zebrafish(323208) transmembrane protein 39A
chicken(418340) transmembrane protein 39A
Horse(100061060) transmembrane protein 39A
domestic cat(101100828) transmembrane protein 39A
dog(478574) transmembrane protein 39A
naked mole-rat(101706406) transmembrane protein 39A
Domestic Rabbit(100356990) transmembrane protein 39A
domestic guinea pig(100719133) transmembrane protein 39A
cow(615128) transmembrane protein 39A
sheep(101105459) transmembrane protein 39A
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA039140 Anti-TMEM39A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018266 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018266 Rosetta Predictions human pricing
NM_001013865 Rosetta Predictions rat pricing
NM_026407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144599 predicted 653
2 SASI_Hs01_00144600 predicted 1363
3 SASI_Hs01_00144601 predicted 1213
4 SASI_Hs02_00351634 predicted 1439
5 SASI_Hs01_00144602 predicted 1086
6 SASI_Hs01_00144603 predicted 1312
7 SASI_Hs01_00144605 predicted 1604
8 SASI_Hs01_00144606 predicted 798
9 SASI_Hs01_00144607 predicted 1609
10 SASI_Hs01_00144608 predicted 850
11 SASI_Hs01_00144604 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071288 predicted 1063
2 SASI_Rn01_00071289 predicted 782
3 SASI_Rn01_00071290 predicted 1193
4 SASI_Rn01_00071291 predicted 1150
5 SASI_Rn01_00071292 predicted 552
6 SASI_Rn01_00071293 predicted 1296
7 SASI_Rn01_00071294 predicted 854
8 SASI_Rn01_00071296 predicted 379
9 SASI_Rn01_00071297 predicted 1527
10 SASI_Rn02_00201133 predicted 937
11 SASI_Rn01_00071295 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152890 predicted 1621
2 SASI_Mm01_00152891 predicted 386
3 SASI_Mm01_00152892 predicted 975
4 SASI_Mm01_00152893 predicted 541
5 SASI_Mm01_00152894 predicted 1013
6 SASI_Mm01_00152895 predicted 638
7 SASI_Mm02_00330201 predicted 1236
8 SASI_Mm01_00152896 predicted 738
9 SASI_Mm01_00152898 predicted 390
10 SASI_Mm01_00152899 predicted 1045
11 SASI_Mm01_00152897 predicted 1526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026407
VALIDATED
TMEM39A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 39A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026407.2-447s1c1
Sequence:CCGGGCTTGAGGAACAGGAATGGTACTCGAGTACCATTCCTGTTCCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026407.2-1526s1c1
Sequence:CCGGCCTTACAATGTAGCAGTGCCTCTCGAGAGGCACTGCTACATTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026407.2-1500s1c1
Sequence:CCGGGCAGATGTTTATATCGAGCCACTCGAGTGGCTCGATATAAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026407.2-1264s1c1
Sequence:CCGGGAGTACCCAGTATTACGACATCTCGAGATGTCGTAATACTGGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026407.2-1152s1c1
Sequence:CCGGGCAATGAAGTAGAATGTCTGACTCGAGTCAGACATTCTACTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026407.2-1418s1c1
Sequence:CCGGGAGCATGGGTTCTACAGCAATCTCGAGATTGCTGTAGAACCCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026407.2-389s1c1
Sequence:CCGGCGGTCAGCTTTACCTTCCATACTCGAGTATGGAAGGTAAAGCTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026407.2-1492s21c1
Sequence:CCGGGCGGCACAGCAGATGTTTATACTCGAGTATAAACATCTGCTGTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026407.2-914s21c1
Sequence:CCGGGGCTATCCGTTTGGTGTTTATCTCGAGATAAACACCAAACGGATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026407.2-1515s21c1
Sequence:CCGGGAGCCATGGGACCTTACAATGCTCGAGCATTGTAAGGTCCCATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026407
VALIDATED
TMEM39A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 39A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026407.2-447s1c1
Sequence:CCGGGCTTGAGGAACAGGAATGGTACTCGAGTACCATTCCTGTTCCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026407.2-1526s1c1
Sequence:CCGGCCTTACAATGTAGCAGTGCCTCTCGAGAGGCACTGCTACATTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026407.2-1500s1c1
Sequence:CCGGGCAGATGTTTATATCGAGCCACTCGAGTGGCTCGATATAAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026407.2-1264s1c1
Sequence:CCGGGAGTACCCAGTATTACGACATCTCGAGATGTCGTAATACTGGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026407.2-1152s1c1
Sequence:CCGGGCAATGAAGTAGAATGTCTGACTCGAGTCAGACATTCTACTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026407.2-1418s1c1
Sequence:CCGGGAGCATGGGTTCTACAGCAATCTCGAGATTGCTGTAGAACCCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026407.2-389s1c1
Sequence:CCGGCGGTCAGCTTTACCTTCCATACTCGAGTATGGAAGGTAAAGCTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026407.2-1492s21c1
Sequence:CCGGGCGGCACAGCAGATGTTTATACTCGAGTATAAACATCTGCTGTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026407.2-914s21c1
Sequence:CCGGGGCTATCCGTTTGGTGTTTATCTCGAGATAAACACCAAACGGATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026407.2-1515s21c1
Sequence:CCGGGAGCCATGGGACCTTACAATGCTCGAGCATTGTAAGGTCCCATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026407
VALIDATED
TMEM39A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 39A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026407.2-447s1c1
Sequence:CCGGGCTTGAGGAACAGGAATGGTACTCGAGTACCATTCCTGTTCCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026407.2-1526s1c1
Sequence:CCGGCCTTACAATGTAGCAGTGCCTCTCGAGAGGCACTGCTACATTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026407.2-1500s1c1
Sequence:CCGGGCAGATGTTTATATCGAGCCACTCGAGTGGCTCGATATAAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026407.2-1264s1c1
Sequence:CCGGGAGTACCCAGTATTACGACATCTCGAGATGTCGTAATACTGGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026407.2-1152s1c1
Sequence:CCGGGCAATGAAGTAGAATGTCTGACTCGAGTCAGACATTCTACTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026407.2-1418s1c1
Sequence:CCGGGAGCATGGGTTCTACAGCAATCTCGAGATTGCTGTAGAACCCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026407.2-389s1c1
Sequence:CCGGCGGTCAGCTTTACCTTCCATACTCGAGTATGGAAGGTAAAGCTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026407.2-1492s21c1
Sequence:CCGGGCGGCACAGCAGATGTTTATACTCGAGTATAAACATCTGCTGTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026407.2-914s21c1
Sequence:CCGGGGCTATCCGTTTGGTGTTTATCTCGAGATAAACACCAAACGGATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026407.2-1515s21c1
Sequence:CCGGGAGCCATGGGACCTTACAATGCTCGAGCATTGTAAGGTCCCATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018266
VALIDATED
TMEM39A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 39A
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018266.1-2261s1c1
Sequence:CCGGGCTGGCTAATAGTATTGGAATCTCGAGATTCCAATACTATTAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018266.1-2757s1c1
Sequence:CCGGCCTACAGCTTTGTACTCAGATCTCGAGATCTGAGTACAAAGCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018266.1-1769s1c1
Sequence:CCGGGAATAGTATTAGGCAGGGCATCTCGAGATGCCCTGCCTAATACTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018266.1-1367s1c1
Sequence:CCGGCGCAACTGTTGCCATCCAAATCTCGAGATTTGGATGGCAACAGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018266.1-1323s1c1
Sequence:CCGGGCACCTCATTATGGTGTGGATCTCGAGATCCACACCATAATGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018266.1-1326s1c1
Sequence:CCGGCCTCATTATGGTGTGGATCAACTCGAGTTGATCCACACCATAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018266.1-1835s1c1
Sequence:CCGGCCTCTCAACAATGAGGGAGAACTCGAGTTCTCCCTCATTGTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018266.1-1609s1c1
Sequence:CCGGCGACCATTAAGGCTGTTAAATCTCGAGATTTAACAGCCTTAATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018266.1-1162s1c1
Sequence:CCGGCCAGACCTCATTCGCAATGAACTCGAGTTCATTGCGAATGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018266.1-1162s21c1
Sequence:CCGGCCAGACCTCATTCGCAATGAACTCGAGTTCATTGCGAATGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018266.1-2052s21c1
Sequence:CCGGGTCCAGTAAAGAGATTGATTTCTCGAGAAATCAATCTCTTTACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018266.1-1598s21c1
Sequence:CCGGTCTTATTTCATCGACCATTAACTCGAGTTAATGGTCGATGAAATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018266.1-626s21c1
Sequence:CCGGTCATTCAGTACATCAACATTTCTCGAGAAATGTTGATGTACTGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018266.1-1655s21c1
Sequence:CCGGTCGTCTTCTATCAGCTCTATTCTCGAGAATAGAGCTGATAGAAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018266
VALIDATED
TMEM39A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 39A
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018266.1-2261s1c1
Sequence:CCGGGCTGGCTAATAGTATTGGAATCTCGAGATTCCAATACTATTAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018266.1-2757s1c1
Sequence:CCGGCCTACAGCTTTGTACTCAGATCTCGAGATCTGAGTACAAAGCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018266.1-1769s1c1
Sequence:CCGGGAATAGTATTAGGCAGGGCATCTCGAGATGCCCTGCCTAATACTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018266.1-1367s1c1
Sequence:CCGGCGCAACTGTTGCCATCCAAATCTCGAGATTTGGATGGCAACAGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018266.1-1323s1c1
Sequence:CCGGGCACCTCATTATGGTGTGGATCTCGAGATCCACACCATAATGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018266.1-1326s1c1
Sequence:CCGGCCTCATTATGGTGTGGATCAACTCGAGTTGATCCACACCATAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018266.1-1835s1c1
Sequence:CCGGCCTCTCAACAATGAGGGAGAACTCGAGTTCTCCCTCATTGTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018266.1-1609s1c1
Sequence:CCGGCGACCATTAAGGCTGTTAAATCTCGAGATTTAACAGCCTTAATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018266.1-1162s1c1
Sequence:CCGGCCAGACCTCATTCGCAATGAACTCGAGTTCATTGCGAATGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018266.1-1162s21c1
Sequence:CCGGCCAGACCTCATTCGCAATGAACTCGAGTTCATTGCGAATGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018266.1-2052s21c1
Sequence:CCGGGTCCAGTAAAGAGATTGATTTCTCGAGAAATCAATCTCTTTACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018266.1-1598s21c1
Sequence:CCGGTCTTATTTCATCGACCATTAACTCGAGTTAATGGTCGATGAAATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018266.1-626s21c1
Sequence:CCGGTCATTCAGTACATCAACATTTCTCGAGAAATGTTGATGTACTGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018266.1-1655s21c1
Sequence:CCGGTCGTCTTCTATCAGCTCTATTCTCGAGAATAGAGCTGATAGAAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018266
VALIDATED
TMEM39A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 39A
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018266.1-2261s1c1
Sequence:CCGGGCTGGCTAATAGTATTGGAATCTCGAGATTCCAATACTATTAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018266.1-2757s1c1
Sequence:CCGGCCTACAGCTTTGTACTCAGATCTCGAGATCTGAGTACAAAGCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018266.1-1769s1c1
Sequence:CCGGGAATAGTATTAGGCAGGGCATCTCGAGATGCCCTGCCTAATACTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018266.1-1367s1c1
Sequence:CCGGCGCAACTGTTGCCATCCAAATCTCGAGATTTGGATGGCAACAGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018266.1-1323s1c1
Sequence:CCGGGCACCTCATTATGGTGTGGATCTCGAGATCCACACCATAATGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018266.1-1326s1c1
Sequence:CCGGCCTCATTATGGTGTGGATCAACTCGAGTTGATCCACACCATAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018266.1-1835s1c1
Sequence:CCGGCCTCTCAACAATGAGGGAGAACTCGAGTTCTCCCTCATTGTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018266.1-1609s1c1
Sequence:CCGGCGACCATTAAGGCTGTTAAATCTCGAGATTTAACAGCCTTAATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018266.1-1162s1c1
Sequence:CCGGCCAGACCTCATTCGCAATGAACTCGAGTTCATTGCGAATGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018266.1-1162s21c1
Sequence:CCGGCCAGACCTCATTCGCAATGAACTCGAGTTCATTGCGAATGAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018266.1-2052s21c1
Sequence:CCGGGTCCAGTAAAGAGATTGATTTCTCGAGAAATCAATCTCTTTACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018266.1-1598s21c1
Sequence:CCGGTCTTATTTCATCGACCATTAACTCGAGTTAATGGTCGATGAAATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018266.1-626s21c1
Sequence:CCGGTCATTCAGTACATCAACATTTCTCGAGAAATGTTGATGTACTGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018266.1-1655s21c1
Sequence:CCGGTCGTCTTCTATCAGCTCTATTCTCGAGAATAGAGCTGATAGAAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks