EMAIL THIS PAGE TO A FRIEND

TMEM39B

transmembrane protein 39B

UniProtKB ID: Q9GZU3, D3DPP4, Q6IA44
Gene ID:
Mouse(230770) transmembrane protein 39b
Rat(362608) transmembrane protein 39b
cow(514263) transmembrane protein 39B
sheep(101117566) transmembrane protein 39B
domestic guinea pig(100730737) transmembrane protein 39B
naked mole-rat(101708656) transmembrane protein 39B
Zebrafish(334110) transmembrane protein 39B
dog(487315) transmembrane protein 39B
domestic cat(101097573) transmembrane protein 39B
chicken(419650) transmembrane protein 39B
Horse(100070394) transmembrane protein 39B
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018056 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018056 Rosetta Predictions human pricing
NM_001014192 Rosetta Predictions rat pricing
NM_199305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098558 predicted 1431
2 SASI_Hs01_00098559 predicted 985
3 SASI_Hs01_00098560 predicted 1332
4 SASI_Hs02_00351189 predicted 487
5 SASI_Hs01_00098561 predicted 780
6 SASI_Hs01_00098562 predicted 717
7 SASI_Hs02_00351190 predicted 238
8 SASI_Hs01_00098563 predicted 1457
9 SASI_Hs02_00351191 predicted 412
10 SASI_Hs02_00351192 predicted 312
11 SASI_Hs01_00098556 predicted 1179
12 SASI_Hs01_00098557 predicted 1343
13 SASI_Hs01_00098564 predicted 1469
14 SASI_Hs01_00098565 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201698 predicted 1375
2 SASI_Rn01_00079435 predicted 1206
3 SASI_Rn01_00079436 predicted 807
4 SASI_Rn01_00079437 predicted 323
5 SASI_Rn01_00079438 predicted 941
6 SASI_Rn01_00079440 predicted 988
7 SASI_Rn01_00079441 predicted 229
8 SASI_Rn01_00079442 predicted 446
9 SASI_Rn01_00079443 predicted 1403
10 SASI_Rn02_00201699 predicted 314
11 SASI_Rn01_00079434 predicted 378
12 SASI_Rn01_00079439 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056290 predicted 382
2 SASI_Mm01_00056291 predicted 821
3 SASI_Mm02_00351432 predicted 1014
4 SASI_Mm01_00056293 predicted 848
5 SASI_Mm01_00056294 predicted 1341
6 SASI_Mm01_00056295 predicted 959
7 SASI_Mm01_00056296 predicted 693
8 SASI_Mm01_00056297 predicted 986
9 SASI_Mm01_00056298 predicted 492
10 SASI_Mm01_00056299 predicted 247
11 SASI_Mm01_00056292 predicted 1026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018056
VALIDATED
TMEM39B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 39B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-733s21c1
Sequence:CCGGATCCGTTTGGGATGTACATTCCTCGAGGAATGTACATCCCAAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-1069s21c1
Sequence:CCGGTGAAGAACACACATTACTATGCTCGAGCATAGTAATGTGTGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-1306s21c1
Sequence:CCGGACAGCAAGAACGTCTACAAAGCTCGAGCTTTGTAGACGTTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-1563s21c1
Sequence:CCGGTTGGGCAAGGCCTACTCATACCTCGAGGTATGAGTAGGCCTTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-1448s21c1
Sequence:CCGGCTATCAGCTGTACTCCCTAATCTCGAGATTAGGGAGTACAGCTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018056.1-1275s1c1
Sequence:CCGGGAAGCACAGCAAGAACGTCTACTCGAGTAGACGTTCTTGCTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018056.1-1488s1c1
Sequence:CCGGCTTCAGCAACTACTATGCCTTCTCGAGAAGGCATAGTAGTTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018056.1-1047s1c1
Sequence:CCGGGAACACACATTACTATGACAACTCGAGTTGTCATAGTAATGTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018056
VALIDATED
TMEM39B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 39B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-733s21c1
Sequence:CCGGATCCGTTTGGGATGTACATTCCTCGAGGAATGTACATCCCAAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-1069s21c1
Sequence:CCGGTGAAGAACACACATTACTATGCTCGAGCATAGTAATGTGTGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-1306s21c1
Sequence:CCGGACAGCAAGAACGTCTACAAAGCTCGAGCTTTGTAGACGTTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-1563s21c1
Sequence:CCGGTTGGGCAAGGCCTACTCATACCTCGAGGTATGAGTAGGCCTTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-1448s21c1
Sequence:CCGGCTATCAGCTGTACTCCCTAATCTCGAGATTAGGGAGTACAGCTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018056.1-1275s1c1
Sequence:CCGGGAAGCACAGCAAGAACGTCTACTCGAGTAGACGTTCTTGCTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018056.1-1488s1c1
Sequence:CCGGCTTCAGCAACTACTATGCCTTCTCGAGAAGGCATAGTAGTTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018056.1-1047s1c1
Sequence:CCGGGAACACACATTACTATGACAACTCGAGTTGTCATAGTAATGTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018056
VALIDATED
TMEM39B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 39B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-733s21c1
Sequence:CCGGATCCGTTTGGGATGTACATTCCTCGAGGAATGTACATCCCAAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-1069s21c1
Sequence:CCGGTGAAGAACACACATTACTATGCTCGAGCATAGTAATGTGTGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-1306s21c1
Sequence:CCGGACAGCAAGAACGTCTACAAAGCTCGAGCTTTGTAGACGTTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-1563s21c1
Sequence:CCGGTTGGGCAAGGCCTACTCATACCTCGAGGTATGAGTAGGCCTTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018056.2-1448s21c1
Sequence:CCGGCTATCAGCTGTACTCCCTAATCTCGAGATTAGGGAGTACAGCTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018056.1-1275s1c1
Sequence:CCGGGAAGCACAGCAAGAACGTCTACTCGAGTAGACGTTCTTGCTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018056.1-1488s1c1
Sequence:CCGGCTTCAGCAACTACTATGCCTTCTCGAGAAGGCATAGTAGTTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018056.1-1047s1c1
Sequence:CCGGGAACACACATTACTATGACAACTCGAGTTGTCATAGTAATGTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199305
TMEM39B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 39B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199305.1-1603s1c1
Sequence:CCGGCCAGGGTGATCCTCCAAACAACTCGAGTTGTTTGGAGGATCACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199305.1-402s1c1
Sequence:CCGGGCACTACATCAACATCTATAACTCGAGTTATAGATGTTGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199305.1-1434s1c1
Sequence:CCGGCTCCTTAATGTCCTCAGAGAACTCGAGTTCTCTGAGGACATTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199305.1-1270s1c1
Sequence:CCGGCTGGTGAAACACAGCAAGAATCTCGAGATTCTTGCTGTGTTTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199305.1-1009s1c1
Sequence:CCGGGCCTACTATGTGGCCTTTGTACTCGAGTACAAAGGCCACATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199305
TMEM39B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 39B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199305.1-1603s1c1
Sequence:CCGGCCAGGGTGATCCTCCAAACAACTCGAGTTGTTTGGAGGATCACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199305.1-402s1c1
Sequence:CCGGGCACTACATCAACATCTATAACTCGAGTTATAGATGTTGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199305.1-1434s1c1
Sequence:CCGGCTCCTTAATGTCCTCAGAGAACTCGAGTTCTCTGAGGACATTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199305.1-1270s1c1
Sequence:CCGGCTGGTGAAACACAGCAAGAATCTCGAGATTCTTGCTGTGTTTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199305.1-1009s1c1
Sequence:CCGGGCCTACTATGTGGCCTTTGTACTCGAGTACAAAGGCCACATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199305
TMEM39B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 39B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199305.1-1603s1c1
Sequence:CCGGCCAGGGTGATCCTCCAAACAACTCGAGTTGTTTGGAGGATCACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199305.1-402s1c1
Sequence:CCGGGCACTACATCAACATCTATAACTCGAGTTATAGATGTTGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199305.1-1434s1c1
Sequence:CCGGCTCCTTAATGTCCTCAGAGAACTCGAGTTCTCTGAGGACATTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199305.1-1270s1c1
Sequence:CCGGCTGGTGAAACACAGCAAGAATCTCGAGATTCTTGCTGTGTTTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199305.1-1009s1c1
Sequence:CCGGGCCTACTATGTGGCCTTTGTACTCGAGTACAAAGGCCACATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks