EMAIL THIS PAGE TO A FRIEND

TMEM40

transmembrane protein 40

UniProtKB ID: Q8WWA1, Q8NAL4, Q9NUZ4
Gene ID:
Mouse(94346) transmembrane protein 40
Rat(680858) transmembrane protein 40
domestic cat(101082386) transmembrane protein 40
dog(100684197) transmembrane protein 40
naked mole-rat(101699711) transmembrane protein 40
domestic guinea pig(100714815) transmembrane protein 40
cow(505490) transmembrane protein 40
sheep(101102938) transmembrane protein 40
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018306 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018306 Rosetta Predictions human pricing
XM_001059205 Rosetta Predictions rat pricing
NM_144805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021884 predicted 725
2 SASI_Hs01_00021885 predicted 1096
3 SASI_Hs01_00021886 predicted 661
4 SASI_Hs01_00021887 predicted 638
5 SASI_Hs01_00021888 predicted 552
6 SASI_Hs01_00021889 predicted 920
7 SASI_Hs01_00021890 predicted 567
8 SASI_Hs01_00021891 predicted 747
9 SASI_Hs01_00021893 predicted 1000
10 SASI_Hs02_00351717 predicted 1031
11 SASI_Hs01_00021892 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292380 predicted 1441
2 SASI_Rn02_00292381 predicted 1386
3 SASI_Rn02_00292382 predicted 1217
4 SASI_Rn02_00292383 predicted 1463
5 SASI_Rn02_00292384 predicted 1377
6 SASI_Rn02_00292385 predicted 1353
7 SASI_Rn02_00292386 predicted 1342
8 SASI_Rn02_00292387 predicted 1271
9 SASI_Rn02_00292388 predicted 1432
10 SASI_Rn02_00292389 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129612 predicted 442
2 SASI_Mm01_00129613 predicted 827
3 SASI_Mm02_00340155 predicted 873
4 SASI_Mm01_00129616 predicted 830
5 SASI_Mm01_00129617 predicted 426
6 SASI_Mm01_00129618 predicted 948
7 SASI_Mm01_00129620 predicted 528
8 SASI_Mm01_00129621 predicted 516
9 SASI_Mm02_00340156 predicted 590
10 SASI_Mm02_00340157 predicted 442
11 SASI_Mm01_00129614 predicted 800
12 SASI_Mm01_00129615 predicted 686
13 SASI_Mm01_00129619 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144805
TMEM40 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 40
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-445s1c1
Sequence:CCGGCCTCTCAGTTAAGAAGACTGACTCGAGTCAGTCTTCTTAACTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-462s1c1
Sequence:CCGGCTGAACATAAAGAAGGATGATCTCGAGATCATCCTTCTTTATGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144805.1-330s1c1
Sequence:CCGGGAAGTGCTAAAGGACGAGCTTCTCGAGAAGCTCGTCCTTTAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-91s1c1
Sequence:CCGGCGGAAGATCACTACCAAGAGACTCGAGTCTCTTGGTAGTGATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144805.1-611s1c1
Sequence:CCGGCATCTATTTCGGGCTCGTGTACTCGAGTACACGAGCCCGAAATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144805.1-957s1c1
Sequence:CCGGGCCATTGCTCATAGGTCAACACTCGAGTGTTGACCTATGAGCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144805.1-816s1c1
Sequence:CCGGCCACACAATAAAGAGCTCTTTCTCGAGAAAGAGCTCTTTATTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-148s1c1
Sequence:CCGGGATATAAGAGAGACAAGTCTTCTCGAGAAGACTTGTCTCTCTTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144805.1-958s1c1
Sequence:CCGGCCATTGCTCATAGGTCAACATCTCGAGATGTTGACCTATGAGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-87s1c1
Sequence:CCGGGAAACGGAAGATCACTACCAACTCGAGTTGGTAGTGATCTTCCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144805
TMEM40 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 40
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-445s1c1
Sequence:CCGGCCTCTCAGTTAAGAAGACTGACTCGAGTCAGTCTTCTTAACTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-462s1c1
Sequence:CCGGCTGAACATAAAGAAGGATGATCTCGAGATCATCCTTCTTTATGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144805.1-330s1c1
Sequence:CCGGGAAGTGCTAAAGGACGAGCTTCTCGAGAAGCTCGTCCTTTAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-91s1c1
Sequence:CCGGCGGAAGATCACTACCAAGAGACTCGAGTCTCTTGGTAGTGATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144805.1-611s1c1
Sequence:CCGGCATCTATTTCGGGCTCGTGTACTCGAGTACACGAGCCCGAAATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144805.1-957s1c1
Sequence:CCGGGCCATTGCTCATAGGTCAACACTCGAGTGTTGACCTATGAGCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144805.1-816s1c1
Sequence:CCGGCCACACAATAAAGAGCTCTTTCTCGAGAAAGAGCTCTTTATTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-148s1c1
Sequence:CCGGGATATAAGAGAGACAAGTCTTCTCGAGAAGACTTGTCTCTCTTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144805.1-958s1c1
Sequence:CCGGCCATTGCTCATAGGTCAACATCTCGAGATGTTGACCTATGAGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-87s1c1
Sequence:CCGGGAAACGGAAGATCACTACCAACTCGAGTTGGTAGTGATCTTCCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144805
TMEM40 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 40
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-445s1c1
Sequence:CCGGCCTCTCAGTTAAGAAGACTGACTCGAGTCAGTCTTCTTAACTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-462s1c1
Sequence:CCGGCTGAACATAAAGAAGGATGATCTCGAGATCATCCTTCTTTATGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144805.1-330s1c1
Sequence:CCGGGAAGTGCTAAAGGACGAGCTTCTCGAGAAGCTCGTCCTTTAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-91s1c1
Sequence:CCGGCGGAAGATCACTACCAAGAGACTCGAGTCTCTTGGTAGTGATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144805.1-611s1c1
Sequence:CCGGCATCTATTTCGGGCTCGTGTACTCGAGTACACGAGCCCGAAATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144805.1-957s1c1
Sequence:CCGGGCCATTGCTCATAGGTCAACACTCGAGTGTTGACCTATGAGCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144805.1-816s1c1
Sequence:CCGGCCACACAATAAAGAGCTCTTTCTCGAGAAAGAGCTCTTTATTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-148s1c1
Sequence:CCGGGATATAAGAGAGACAAGTCTTCTCGAGAAGACTTGTCTCTCTTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144805.1-958s1c1
Sequence:CCGGCCATTGCTCATAGGTCAACATCTCGAGATGTTGACCTATGAGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144805.1-87s1c1
Sequence:CCGGGAAACGGAAGATCACTACCAACTCGAGTTGGTAGTGATCTTCCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018306
TMEM40 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 40
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018306.2-464s1c1
Sequence:CCGGGAGCTTCAACTCTATGGAGATCTCGAGATCTCCATAGAGTTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018306.2-668s1c1
Sequence:CCGGGCAGACTGGTTCATGTCTCTTCTCGAGAAGAGACATGAACCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018306.2-719s21c1
Sequence:CCGGGAAACCGTTGGCATCTACTTCCTCGAGGAAGTAGATGCCAACGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018306.2-459s21c1
Sequence:CCGGAGGATGAGCTTCAACTCTATGCTCGAGCATAGAGTTGAAGCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018306.2-569s21c1
Sequence:CCGGCAGTTAAGAAGACTGAATATACTCGAGTATATTCAGTCTTCTTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018306.2-1525s21c1
Sequence:CCGGACCAAATGTGGCGGTACATACCTCGAGGTATGTACCGCCACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018306.2-646s21c1
Sequence:CCGGGCTGGTGTGTTATCACTATTACTCGAGTAATAGTGATAACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018306
TMEM40 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 40
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018306.2-464s1c1
Sequence:CCGGGAGCTTCAACTCTATGGAGATCTCGAGATCTCCATAGAGTTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018306.2-668s1c1
Sequence:CCGGGCAGACTGGTTCATGTCTCTTCTCGAGAAGAGACATGAACCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018306.2-719s21c1
Sequence:CCGGGAAACCGTTGGCATCTACTTCCTCGAGGAAGTAGATGCCAACGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018306.2-459s21c1
Sequence:CCGGAGGATGAGCTTCAACTCTATGCTCGAGCATAGAGTTGAAGCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018306.2-569s21c1
Sequence:CCGGCAGTTAAGAAGACTGAATATACTCGAGTATATTCAGTCTTCTTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018306.2-1525s21c1
Sequence:CCGGACCAAATGTGGCGGTACATACCTCGAGGTATGTACCGCCACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018306.2-646s21c1
Sequence:CCGGGCTGGTGTGTTATCACTATTACTCGAGTAATAGTGATAACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018306
TMEM40 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 40
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018306.2-464s1c1
Sequence:CCGGGAGCTTCAACTCTATGGAGATCTCGAGATCTCCATAGAGTTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018306.2-668s1c1
Sequence:CCGGGCAGACTGGTTCATGTCTCTTCTCGAGAAGAGACATGAACCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018306.2-719s21c1
Sequence:CCGGGAAACCGTTGGCATCTACTTCCTCGAGGAAGTAGATGCCAACGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018306.2-459s21c1
Sequence:CCGGAGGATGAGCTTCAACTCTATGCTCGAGCATAGAGTTGAAGCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018306.2-569s21c1
Sequence:CCGGCAGTTAAGAAGACTGAATATACTCGAGTATATTCAGTCTTCTTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018306.2-1525s21c1
Sequence:CCGGACCAAATGTGGCGGTACATACCTCGAGGTATGTACCGCCACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018306.2-646s21c1
Sequence:CCGGGCTGGTGTGTTATCACTATTACTCGAGTAATAGTGATAACACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks