EMAIL THIS PAGE TO A FRIEND

TMEM41A

transmembrane protein 41A

Synonyms: 2900010K02Rik
UniProtKB ID: Q96HV5, A8K4B3, D3DNU2, Q6ZMJ0
Gene ID:
Mouse(66664) transmembrane protein 41a
Rat(681708) transmembrane protein 41a
cow(505368) transmembrane protein 41A
sheep(101106135) transmembrane protein 41A
domestic guinea pig(100733261) transmembrane protein 41A
naked mole-rat(101698126) transmembrane protein 41A
chicken(424875) transmembrane protein 41A
domestic cat(101083616) transmembrane protein 41A
dog(488111) transmembrane protein 41A
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080652 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080652 Rosetta Predictions human pricing
NM_001100805 Rosetta Predictions rat pricing
NM_025693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222771 predicted 249
2 SASI_Hs01_00222772 predicted 208
3 SASI_Hs01_00222773 predicted 249
4 SASI_Hs01_00222774 predicted 270
5 SASI_Hs01_00222775 predicted 207
6 SASI_Hs01_00222776 predicted 248
7 SASI_Hs01_00222777 predicted 230
8 SASI_Hs01_00222778 predicted 267
9 SASI_Hs01_00222779 predicted 235
10 SASI_Hs01_00222780 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210602 predicted 1006
2 SASI_Rn02_00210603 predicted 273
3 SASI_Rn02_00210604 predicted 875
4 SASI_Rn02_00210605 predicted 703
5 SASI_Rn02_00210606 predicted 497
6 SASI_Rn02_00210607 predicted 1191
7 SASI_Rn02_00210608 predicted 992
8 SASI_Rn02_00210609 predicted 801
9 SASI_Rn02_00210610 predicted 241
10 SASI_Rn02_00210611 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117541 predicted 1028
2 SASI_Mm01_00117542 predicted 1000
3 SASI_Mm01_00117543 predicted 1015
4 SASI_Mm02_00328855 predicted 785
5 SASI_Mm01_00117544 predicted 413
6 SASI_Mm01_00117546 predicted 707
7 SASI_Mm01_00117547 predicted 278
8 SASI_Mm02_00328856 predicted 1008
9 SASI_Mm01_00117549 predicted 236
10 SASI_Mm01_00117550 predicted 625
11 SASI_Mm01_00117545 predicted 854
12 SASI_Mm01_00117548 predicted 724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025693
VALIDATED
TMEM41A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 41A
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-373s21c1
Sequence:CCGGTTTGCTGTGCTGCGTGTTGACCTCGAGGTCAACACGCAGCACAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-229s21c1
Sequence:CCGGTCTTCGAGAGTACCGGAAAGACTCGAGTCTTTCCGGTACTCTCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-758s21c1
Sequence:CCGGGTTCCGGGAACGCTCATCAAACTCGAGTTTGATGAGCGTTCCCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-444s21c1
Sequence:CCGGAGCTGGTCATCTCCTACTTTCCTCGAGGAAAGTAGGAGATGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-625s21c1
Sequence:CCGGGCTCATCGGTTTGATCCCTTACTCGAGTAAGGGATCAAACCGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025693.3-1068s21c1
Sequence:CCGGCCCTGAGATGTCTTGGAAGATCTCGAGATCTTCCAAGACATCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025693.1-1071s1c1
Sequence:CCGGCCCTGAGATGTCTTGGAAGATCTCGAGATCTTCCAAGACATCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025693.1-628s1c1
Sequence:CCGGGCTCATCGGTTTGATCCCTTACTCGAGTAAGGGATCAAACCGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025693.1-105s1c1
Sequence:CCGGCCTTCGCATTATACCTGCTCTCTCGAGAGAGCAGGTATAATGCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025693.1-505s1c1
Sequence:CCGGGAACCGAAACAGCCTGTTCTTCTCGAGAAGAACAGGCTGTTTCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025693.1-805s1c1
Sequence:CCGGGCTGAGTGAAACAAGCGACATCTCGAGATGTCGCTTGTTTCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025693
VALIDATED
TMEM41A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 41A
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-373s21c1
Sequence:CCGGTTTGCTGTGCTGCGTGTTGACCTCGAGGTCAACACGCAGCACAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-229s21c1
Sequence:CCGGTCTTCGAGAGTACCGGAAAGACTCGAGTCTTTCCGGTACTCTCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-758s21c1
Sequence:CCGGGTTCCGGGAACGCTCATCAAACTCGAGTTTGATGAGCGTTCCCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-444s21c1
Sequence:CCGGAGCTGGTCATCTCCTACTTTCCTCGAGGAAAGTAGGAGATGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-625s21c1
Sequence:CCGGGCTCATCGGTTTGATCCCTTACTCGAGTAAGGGATCAAACCGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025693.3-1068s21c1
Sequence:CCGGCCCTGAGATGTCTTGGAAGATCTCGAGATCTTCCAAGACATCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025693.1-1071s1c1
Sequence:CCGGCCCTGAGATGTCTTGGAAGATCTCGAGATCTTCCAAGACATCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025693.1-628s1c1
Sequence:CCGGGCTCATCGGTTTGATCCCTTACTCGAGTAAGGGATCAAACCGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025693.1-105s1c1
Sequence:CCGGCCTTCGCATTATACCTGCTCTCTCGAGAGAGCAGGTATAATGCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025693.1-505s1c1
Sequence:CCGGGAACCGAAACAGCCTGTTCTTCTCGAGAAGAACAGGCTGTTTCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025693.1-805s1c1
Sequence:CCGGGCTGAGTGAAACAAGCGACATCTCGAGATGTCGCTTGTTTCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025693
VALIDATED
TMEM41A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 41A
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-373s21c1
Sequence:CCGGTTTGCTGTGCTGCGTGTTGACCTCGAGGTCAACACGCAGCACAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-229s21c1
Sequence:CCGGTCTTCGAGAGTACCGGAAAGACTCGAGTCTTTCCGGTACTCTCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-758s21c1
Sequence:CCGGGTTCCGGGAACGCTCATCAAACTCGAGTTTGATGAGCGTTCCCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-444s21c1
Sequence:CCGGAGCTGGTCATCTCCTACTTTCCTCGAGGAAAGTAGGAGATGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025693.3-625s21c1
Sequence:CCGGGCTCATCGGTTTGATCCCTTACTCGAGTAAGGGATCAAACCGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025693.3-1068s21c1
Sequence:CCGGCCCTGAGATGTCTTGGAAGATCTCGAGATCTTCCAAGACATCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025693.1-1071s1c1
Sequence:CCGGCCCTGAGATGTCTTGGAAGATCTCGAGATCTTCCAAGACATCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025693.1-628s1c1
Sequence:CCGGGCTCATCGGTTTGATCCCTTACTCGAGTAAGGGATCAAACCGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025693.1-105s1c1
Sequence:CCGGCCTTCGCATTATACCTGCTCTCTCGAGAGAGCAGGTATAATGCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025693.1-505s1c1
Sequence:CCGGGAACCGAAACAGCCTGTTCTTCTCGAGAAGAACAGGCTGTTTCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025693.1-805s1c1
Sequence:CCGGGCTGAGTGAAACAAGCGACATCTCGAGATGTCGCTTGTTTCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080652
VALIDATED
TMEM41A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 41A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080652.3-1045s21c1
Sequence:CCGGGCTCTTGAAGGTGTATTACATCTCGAGATGTAATACACCTTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080652.3-538s21c1
Sequence:CCGGGAGAACAGAAACAGCTTGTTTCTCGAGAAACAAGCTGTTTCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080652.3-588s21c1
Sequence:CCGGCATGACACCAAACTGGTTCTTCTCGAGAAGAACCAGTTTGGTGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080652.3-645s21c1
Sequence:CCGGGCAGTTCTTCTTCTCAGTTCTCTCGAGAGAACTGAGAAGAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-602s1c1
Sequence:CCGGGCAGTTCTTCTTCTCAGTTCTCTCGAGAGAACTGAGAAGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080652.2-434s1c1
Sequence:CCGGCAAACAGTTGGTGGTGTCCTACTCGAGTAGGACACCACCAACTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080652.2-590s1c1
Sequence:CCGGCATTCCCATCGTGCAGTTCTTCTCGAGAAGAACTGCACGATGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-545s1c1
Sequence:CCGGCATGACACCAAACTGGTTCTTCTCGAGAAGAACCAGTTTGGTGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-611s1c1
Sequence:CCGGCTTCTCAGTTCTTATCGGTTTCTCGAGAAACCGATAAGAACTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-495s1c1
Sequence:CCGGGAGAACAGAAACAGCTTGTTTCTCGAGAAACAAGCTGTTTCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-1003s1c1
Sequence:CCGGGCTCTTGAAGGTGTATTACATCTCGAGATGTAATACACCTTCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080652.2-603s1c1
Sequence:CCGGCAGTTCTTCTTCTCAGTTCTTCTCGAGAAGAACTGAGAAGAAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080652
VALIDATED
TMEM41A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 41A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080652.3-1045s21c1
Sequence:CCGGGCTCTTGAAGGTGTATTACATCTCGAGATGTAATACACCTTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080652.3-538s21c1
Sequence:CCGGGAGAACAGAAACAGCTTGTTTCTCGAGAAACAAGCTGTTTCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080652.3-588s21c1
Sequence:CCGGCATGACACCAAACTGGTTCTTCTCGAGAAGAACCAGTTTGGTGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080652.3-645s21c1
Sequence:CCGGGCAGTTCTTCTTCTCAGTTCTCTCGAGAGAACTGAGAAGAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-602s1c1
Sequence:CCGGGCAGTTCTTCTTCTCAGTTCTCTCGAGAGAACTGAGAAGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080652.2-434s1c1
Sequence:CCGGCAAACAGTTGGTGGTGTCCTACTCGAGTAGGACACCACCAACTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080652.2-590s1c1
Sequence:CCGGCATTCCCATCGTGCAGTTCTTCTCGAGAAGAACTGCACGATGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-545s1c1
Sequence:CCGGCATGACACCAAACTGGTTCTTCTCGAGAAGAACCAGTTTGGTGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-611s1c1
Sequence:CCGGCTTCTCAGTTCTTATCGGTTTCTCGAGAAACCGATAAGAACTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-495s1c1
Sequence:CCGGGAGAACAGAAACAGCTTGTTTCTCGAGAAACAAGCTGTTTCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-1003s1c1
Sequence:CCGGGCTCTTGAAGGTGTATTACATCTCGAGATGTAATACACCTTCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080652.2-603s1c1
Sequence:CCGGCAGTTCTTCTTCTCAGTTCTTCTCGAGAAGAACTGAGAAGAAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080652
VALIDATED
TMEM41A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 41A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080652.3-1045s21c1
Sequence:CCGGGCTCTTGAAGGTGTATTACATCTCGAGATGTAATACACCTTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080652.3-538s21c1
Sequence:CCGGGAGAACAGAAACAGCTTGTTTCTCGAGAAACAAGCTGTTTCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080652.3-588s21c1
Sequence:CCGGCATGACACCAAACTGGTTCTTCTCGAGAAGAACCAGTTTGGTGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080652.3-645s21c1
Sequence:CCGGGCAGTTCTTCTTCTCAGTTCTCTCGAGAGAACTGAGAAGAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-602s1c1
Sequence:CCGGGCAGTTCTTCTTCTCAGTTCTCTCGAGAGAACTGAGAAGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080652.2-434s1c1
Sequence:CCGGCAAACAGTTGGTGGTGTCCTACTCGAGTAGGACACCACCAACTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080652.2-590s1c1
Sequence:CCGGCATTCCCATCGTGCAGTTCTTCTCGAGAAGAACTGCACGATGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-545s1c1
Sequence:CCGGCATGACACCAAACTGGTTCTTCTCGAGAAGAACCAGTTTGGTGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-611s1c1
Sequence:CCGGCTTCTCAGTTCTTATCGGTTTCTCGAGAAACCGATAAGAACTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-495s1c1
Sequence:CCGGGAGAACAGAAACAGCTTGTTTCTCGAGAAACAAGCTGTTTCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_080652.2-1003s1c1
Sequence:CCGGGCTCTTGAAGGTGTATTACATCTCGAGATGTAATACACCTTCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080652.2-603s1c1
Sequence:CCGGCAGTTCTTCTTCTCAGTTCTTCTCGAGAAGAACTGAGAAGAAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks