EMAIL THIS PAGE TO A FRIEND

TMEM41B

transmembrane protein 41B

UniProtKB ID: Q5BJD5, D3DQU9, E9PP29, Q15055, Q4G0P0
Gene ID:
Mouse(233724) transmembrane protein 41B
Rat(361626) transmembrane protein 41B
Zebrafish(561208) transmembrane protein 41B
dog(476845) transmembrane protein 41B
domestic cat(101085920) transmembrane protein 41B
chicken(423047) transmembrane protein 41B
naked mole-rat(101700424) transmembrane protein 41B
cow(616372) transmembrane protein 41B
sheep(101105684) transmembrane protein 41B
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA014946 Anti-TMEM41B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153525 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153525 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153525 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015012 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015012 Rosetta Predictions human pricing
NM_001012358 Rosetta Predictions rat pricing
NM_153525 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171330 predicted 463
2 SASI_Hs02_00346782 predicted 532
3 SASI_Hs01_00171331 predicted 709
4 SASI_Hs01_00171332 predicted 1388
5 SASI_Hs01_00171333 predicted 689
6 SASI_Hs01_00171334 predicted 1377
7 SASI_Hs01_00171335 predicted 331
8 SASI_Hs02_00346783 predicted 723
9 SASI_Hs01_00171336 predicted 580
10 SASI_Hs01_00171339 predicted 681
11 SASI_Hs01_00171337 predicted 1385
12 SASI_Hs01_00171338 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055953 predicted 282
2 SASI_Rn01_00055954 predicted 283
3 SASI_Rn01_00055956 predicted 218
4 SASI_Rn01_00055957 predicted 524
5 SASI_Rn02_00200549 predicted 274
6 SASI_Rn01_00055958 predicted 1277
7 SASI_Rn01_00055959 predicted 638
8 SASI_Rn01_00055960 predicted 609
9 SASI_Rn01_00055961 predicted 557
10 SASI_Rn01_00055962 predicted 430
11 SASI_Rn01_00055955 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060984 predicted 769
2 SASI_Mm01_00060985 predicted 252
3 SASI_Mm01_00060986 predicted 301
4 SASI_Mm01_00060987 predicted 307
5 SASI_Mm01_00060988 predicted 922
6 SASI_Mm02_00343289 predicted 532
7 SASI_Mm02_00343290 predicted 452
8 SASI_Mm01_00060990 predicted 292
9 SASI_Mm01_00060991 predicted 243
10 SASI_Mm01_00060992 predicted 933
11 SASI_Mm01_00060989 predicted 805
12 SASI_Mm01_00060993 predicted 805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153525
VALIDATED
TMEM41B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 41B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153525.2-481s1c1
Sequence:CCGGGTACAAGTATTGGTTGCTTATCTCGAGATAAGCAACCAATACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153525.2-944s1c1
Sequence:CCGGCGGTATTTATTCTGATGGTTTCTCGAGAAACCATCAGAATAAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153525.2-2509s1c1
Sequence:CCGGCCATGTAACATGCTTGTAATTCTCGAGAATTACAAGCATGTTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153525.2-636s1c1
Sequence:CCGGCTGCTACATGCTCTCCTACTTCTCGAGAAGTAGGAGAGCATGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153525.2-773s1c1
Sequence:CCGGCGTTTCTTCCTAATTGGTTTACTCGAGTAAACCAATTAGGAAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153525.5-634s21c1
Sequence:CCGGCTGCTACATGCTCTCCTACTTCTCGAGAAGTAGGAGAGCATGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153525.5-479s21c1
Sequence:CCGGGTACAAGTATTGGTTGCTTATCTCGAGATAAGCAACCAATACTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153525.5-771s21c1
Sequence:CCGGCGTTTCTTCCTAATTGGTTTACTCGAGTAAACCAATTAGGAAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153525.5-942s21c1
Sequence:CCGGCGGTATTTATTCTGATGGTTTCTCGAGAAACCATCAGAATAAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153525
VALIDATED
TMEM41B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 41B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153525.2-481s1c1
Sequence:CCGGGTACAAGTATTGGTTGCTTATCTCGAGATAAGCAACCAATACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153525.2-944s1c1
Sequence:CCGGCGGTATTTATTCTGATGGTTTCTCGAGAAACCATCAGAATAAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153525.2-2509s1c1
Sequence:CCGGCCATGTAACATGCTTGTAATTCTCGAGAATTACAAGCATGTTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153525.2-636s1c1
Sequence:CCGGCTGCTACATGCTCTCCTACTTCTCGAGAAGTAGGAGAGCATGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153525.2-773s1c1
Sequence:CCGGCGTTTCTTCCTAATTGGTTTACTCGAGTAAACCAATTAGGAAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153525.5-634s21c1
Sequence:CCGGCTGCTACATGCTCTCCTACTTCTCGAGAAGTAGGAGAGCATGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153525.5-479s21c1
Sequence:CCGGGTACAAGTATTGGTTGCTTATCTCGAGATAAGCAACCAATACTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153525.5-771s21c1
Sequence:CCGGCGTTTCTTCCTAATTGGTTTACTCGAGTAAACCAATTAGGAAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153525.5-942s21c1
Sequence:CCGGCGGTATTTATTCTGATGGTTTCTCGAGAAACCATCAGAATAAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153525
VALIDATED
TMEM41B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 41B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153525.2-481s1c1
Sequence:CCGGGTACAAGTATTGGTTGCTTATCTCGAGATAAGCAACCAATACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153525.2-944s1c1
Sequence:CCGGCGGTATTTATTCTGATGGTTTCTCGAGAAACCATCAGAATAAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153525.2-2509s1c1
Sequence:CCGGCCATGTAACATGCTTGTAATTCTCGAGAATTACAAGCATGTTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153525.2-636s1c1
Sequence:CCGGCTGCTACATGCTCTCCTACTTCTCGAGAAGTAGGAGAGCATGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153525.2-773s1c1
Sequence:CCGGCGTTTCTTCCTAATTGGTTTACTCGAGTAAACCAATTAGGAAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153525.5-634s21c1
Sequence:CCGGCTGCTACATGCTCTCCTACTTCTCGAGAAGTAGGAGAGCATGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153525.5-479s21c1
Sequence:CCGGGTACAAGTATTGGTTGCTTATCTCGAGATAAGCAACCAATACTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153525.5-771s21c1
Sequence:CCGGCGTTTCTTCCTAATTGGTTTACTCGAGTAAACCAATTAGGAAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153525.5-942s21c1
Sequence:CCGGCGGTATTTATTCTGATGGTTTCTCGAGAAACCATCAGAATAAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015012
VALIDATED
TMEM41B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 41B
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015012.1-1308s1c1
Sequence:CCGGGACTGTCAAGAAAGGACCCTTCTCGAGAAGGGTCCTTTCTTGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015012.1-1047s1c1
Sequence:CCGGGCAGGAACAACACTGTATCAACTCGAGTTGATACAGTGTTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015012.1-842s1c1
Sequence:CCGGCCTAACAGAGAAAGCAGTAAACTCGAGTTTACTGCTTTCTCTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015012.1-1089s1c1
Sequence:CCGGGTTTCCTGGAACTCAATATTTCTCGAGAAATATTGAGTTCCAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015012.1-876s1c1
Sequence:CCGGGTTGAACGTCATAGAGAACATCTCGAGATGTTCTCTATGACGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015012.1-787s1c1
Sequence:CCGGCCTCTTTCTGTTATATGCTTTCTCGAGAAAGCATATAACAGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015012.1-922s1c1
Sequence:CCGGGAATAACACCATTTCTGCCTACTCGAGTAGGCAGAAATGGTGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015012.1-1051s1c1
Sequence:CCGGGAACAACACTGTATCAACTTACTCGAGTAAGTTGATACAGTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015012.1-1394s1c1
Sequence:CCGGGCCCATGTAAATTCAAGCTTTCTCGAGAAAGCTTGAATTTACATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015012.1-882s1c1
Sequence:CCGGCGTCATAGAGAACATCTCATTCTCGAGAATGAGATGTTCTCTATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015012.1-842s21c1
Sequence:CCGGCCTAACAGAGAAAGCAGTAAACTCGAGTTTACTGCTTTCTCTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015012.1-876s21c1
Sequence:CCGGGTTGAACGTCATAGAGAACATCTCGAGATGTTCTCTATGACGTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015012.1-1394s21c1
Sequence:CCGGGCCCATGTAAATTCAAGCTTTCTCGAGAAAGCTTGAATTTACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015012.1-1089s21c1
Sequence:CCGGGTTTCCTGGAACTCAATATTTCTCGAGAAATATTGAGTTCCAGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015012
VALIDATED
TMEM41B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 41B
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015012.1-1308s1c1
Sequence:CCGGGACTGTCAAGAAAGGACCCTTCTCGAGAAGGGTCCTTTCTTGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015012.1-1047s1c1
Sequence:CCGGGCAGGAACAACACTGTATCAACTCGAGTTGATACAGTGTTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015012.1-842s1c1
Sequence:CCGGCCTAACAGAGAAAGCAGTAAACTCGAGTTTACTGCTTTCTCTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015012.1-1089s1c1
Sequence:CCGGGTTTCCTGGAACTCAATATTTCTCGAGAAATATTGAGTTCCAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015012.1-876s1c1
Sequence:CCGGGTTGAACGTCATAGAGAACATCTCGAGATGTTCTCTATGACGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015012.1-787s1c1
Sequence:CCGGCCTCTTTCTGTTATATGCTTTCTCGAGAAAGCATATAACAGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015012.1-922s1c1
Sequence:CCGGGAATAACACCATTTCTGCCTACTCGAGTAGGCAGAAATGGTGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015012.1-1051s1c1
Sequence:CCGGGAACAACACTGTATCAACTTACTCGAGTAAGTTGATACAGTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015012.1-1394s1c1
Sequence:CCGGGCCCATGTAAATTCAAGCTTTCTCGAGAAAGCTTGAATTTACATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015012.1-882s1c1
Sequence:CCGGCGTCATAGAGAACATCTCATTCTCGAGAATGAGATGTTCTCTATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015012.1-842s21c1
Sequence:CCGGCCTAACAGAGAAAGCAGTAAACTCGAGTTTACTGCTTTCTCTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015012.1-876s21c1
Sequence:CCGGGTTGAACGTCATAGAGAACATCTCGAGATGTTCTCTATGACGTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015012.1-1394s21c1
Sequence:CCGGGCCCATGTAAATTCAAGCTTTCTCGAGAAAGCTTGAATTTACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015012.1-1089s21c1
Sequence:CCGGGTTTCCTGGAACTCAATATTTCTCGAGAAATATTGAGTTCCAGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015012
VALIDATED
TMEM41B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 41B
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015012.1-1308s1c1
Sequence:CCGGGACTGTCAAGAAAGGACCCTTCTCGAGAAGGGTCCTTTCTTGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015012.1-1047s1c1
Sequence:CCGGGCAGGAACAACACTGTATCAACTCGAGTTGATACAGTGTTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015012.1-842s1c1
Sequence:CCGGCCTAACAGAGAAAGCAGTAAACTCGAGTTTACTGCTTTCTCTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015012.1-1089s1c1
Sequence:CCGGGTTTCCTGGAACTCAATATTTCTCGAGAAATATTGAGTTCCAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015012.1-876s1c1
Sequence:CCGGGTTGAACGTCATAGAGAACATCTCGAGATGTTCTCTATGACGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015012.1-787s1c1
Sequence:CCGGCCTCTTTCTGTTATATGCTTTCTCGAGAAAGCATATAACAGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015012.1-922s1c1
Sequence:CCGGGAATAACACCATTTCTGCCTACTCGAGTAGGCAGAAATGGTGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015012.1-1051s1c1
Sequence:CCGGGAACAACACTGTATCAACTTACTCGAGTAAGTTGATACAGTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015012.1-1394s1c1
Sequence:CCGGGCCCATGTAAATTCAAGCTTTCTCGAGAAAGCTTGAATTTACATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015012.1-882s1c1
Sequence:CCGGCGTCATAGAGAACATCTCATTCTCGAGAATGAGATGTTCTCTATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015012.1-842s21c1
Sequence:CCGGCCTAACAGAGAAAGCAGTAAACTCGAGTTTACTGCTTTCTCTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015012.1-876s21c1
Sequence:CCGGGTTGAACGTCATAGAGAACATCTCGAGATGTTCTCTATGACGTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015012.1-1394s21c1
Sequence:CCGGGCCCATGTAAATTCAAGCTTTCTCGAGAAAGCTTGAATTTACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015012.1-1089s21c1
Sequence:CCGGGTTTCCTGGAACTCAATATTTCTCGAGAAATATTGAGTTCCAGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks