EMAIL THIS PAGE TO A FRIEND

TMEM42

transmembrane protein 42

UniProtKB ID: Q69YG0, Q8WUQ6
Gene ID:
Mouse(66079) transmembrane protein 42
Rat(363171) transmembrane protein 42
cow(613945) transmembrane protein 42
sheep(101105286) transmembrane protein 42
domestic guinea pig(100713134) transmembrane protein 42
naked mole-rat(101704718) transmembrane protein 42
chicken(420707) transmembrane protein 42
dog(609611) transmembrane protein 42
domestic cat(101081198) transmembrane protein 42
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144638 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025339 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025339 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025339 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034491 MISSION® esiRNA esiRNA human TMEM42 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144638 Rosetta Predictions human pricing
XM_001078553 Rosetta Predictions rat pricing
XM_343510 Rosetta Predictions rat pricing
NM_025339 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134499 predicted 207
2 SASI_Hs01_00134500 predicted 663
3 SASI_Hs01_00134501 predicted 255
4 SASI_Hs02_00364481 predicted 555
5 SASI_Hs01_00134502 predicted 215
6 SASI_Hs01_00134503 predicted 349
7 SASI_Hs02_00364482 predicted 300
8 SASI_Hs01_00134505 predicted 687
9 SASI_Hs01_00134506 predicted 483
10 SASI_Hs01_00134507 predicted 507
11 SASI_Hs01_00134504 predicted 535
12 SASI_Hs01_00134508 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361236 predicted 876
2 SASI_Rn02_00361237 predicted 879
3 SASI_Rn02_00361238 predicted 1150
4 SASI_Rn02_00361239 predicted 925
5 SASI_Rn02_00361240 predicted 747
6 SASI_Rn02_00361241 predicted 877
7 SASI_Rn02_00361242 predicted 1029
8 SASI_Rn02_00361243 predicted 1159
9 SASI_Rn02_00361244 predicted 1171
10 SASI_Rn02_00361245 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395954 predicted 875
2 SASI_Rn02_00395955 predicted 880
3 SASI_Rn02_00395956 predicted 1150
4 SASI_Rn02_00395957 predicted 921
5 SASI_Rn02_00395958 predicted 739
6 SASI_Rn02_00395959 predicted 877
7 SASI_Rn02_00395960 predicted 1026
8 SASI_Rn02_00395961 predicted 1158
9 SASI_Rn02_00395962 predicted 1176
10 SASI_Rn02_00395963 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025339 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092647 predicted 359
2 SASI_Mm01_00092648 predicted 298
3 SASI_Mm01_00092649 predicted 621
4 SASI_Mm02_00328000 predicted 397
5 SASI_Mm01_00092651 predicted 357
6 SASI_Mm01_00092652 predicted 569
7 SASI_Mm01_00092653 predicted 247
8 SASI_Mm01_00092654 predicted 242
9 SASI_Mm01_00092655 predicted 577
10 SASI_Mm01_00092656 predicted 273
11 SASI_Mm01_00092650 predicted 625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144638
VALIDATED
TMEM42 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 42
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_144638.1-798s21c1
Sequence:CCGGCGCTGTAATTATTGTCCTGTTCTCGAGAACAGGACAATAATTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144638.1-785s21c1
Sequence:CCGGGTACTTGAAACCACGCTGTAACTCGAGTTACAGCGTGGTTTCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144638.1-212s21c1
Sequence:CCGGGTTTATGCGTCTTAGGCATTACTCGAGTAATGCCTAAGACGCATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_144638.1-305s21c1
Sequence:CCGGCCATTGCATCTGTCACAGTGACTCGAGTCACTGTGACAGATGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144638.1-254s1c1
Sequence:CCGGCTCTGATGTGGACCTTCTTTACTCGAGTAAAGAAGGTCCACATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-798s1c1
Sequence:CCGGCGCTGTAATTATTGTCCTGTTCTCGAGAACAGGACAATAATTACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-773s1c1
Sequence:CCGGGCTTTGTGTATGGTACTTGAACTCGAGTTCAAGTACCATACACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149305    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144638.1-830s1c1
Sequence:CCGGGCCAGTCATGTAACTCTAGAACTCGAGTTCTAGAGTTACATGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-212s1c1
Sequence:CCGGGTTTATGCGTCTTAGGCATTACTCGAGTAATGCCTAAGACGCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-785s1c1
Sequence:CCGGGTACTTGAAACCACGCTGTAACTCGAGTTACAGCGTGGTTTCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-305s1c1
Sequence:CCGGCCATTGCATCTGTCACAGTGACTCGAGTCACTGTGACAGATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144638
VALIDATED
TMEM42 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 42
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_144638.1-798s21c1
Sequence:CCGGCGCTGTAATTATTGTCCTGTTCTCGAGAACAGGACAATAATTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144638.1-785s21c1
Sequence:CCGGGTACTTGAAACCACGCTGTAACTCGAGTTACAGCGTGGTTTCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144638.1-212s21c1
Sequence:CCGGGTTTATGCGTCTTAGGCATTACTCGAGTAATGCCTAAGACGCATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_144638.1-305s21c1
Sequence:CCGGCCATTGCATCTGTCACAGTGACTCGAGTCACTGTGACAGATGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144638.1-254s1c1
Sequence:CCGGCTCTGATGTGGACCTTCTTTACTCGAGTAAAGAAGGTCCACATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-798s1c1
Sequence:CCGGCGCTGTAATTATTGTCCTGTTCTCGAGAACAGGACAATAATTACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-773s1c1
Sequence:CCGGGCTTTGTGTATGGTACTTGAACTCGAGTTCAAGTACCATACACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149305    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144638.1-830s1c1
Sequence:CCGGGCCAGTCATGTAACTCTAGAACTCGAGTTCTAGAGTTACATGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-212s1c1
Sequence:CCGGGTTTATGCGTCTTAGGCATTACTCGAGTAATGCCTAAGACGCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-785s1c1
Sequence:CCGGGTACTTGAAACCACGCTGTAACTCGAGTTACAGCGTGGTTTCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-305s1c1
Sequence:CCGGCCATTGCATCTGTCACAGTGACTCGAGTCACTGTGACAGATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144638
VALIDATED
TMEM42 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 42
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_144638.1-798s21c1
Sequence:CCGGCGCTGTAATTATTGTCCTGTTCTCGAGAACAGGACAATAATTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144638.1-785s21c1
Sequence:CCGGGTACTTGAAACCACGCTGTAACTCGAGTTACAGCGTGGTTTCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144638.1-212s21c1
Sequence:CCGGGTTTATGCGTCTTAGGCATTACTCGAGTAATGCCTAAGACGCATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_144638.1-305s21c1
Sequence:CCGGCCATTGCATCTGTCACAGTGACTCGAGTCACTGTGACAGATGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144638.1-254s1c1
Sequence:CCGGCTCTGATGTGGACCTTCTTTACTCGAGTAAAGAAGGTCCACATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-798s1c1
Sequence:CCGGCGCTGTAATTATTGTCCTGTTCTCGAGAACAGGACAATAATTACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-773s1c1
Sequence:CCGGGCTTTGTGTATGGTACTTGAACTCGAGTTCAAGTACCATACACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149305    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144638.1-830s1c1
Sequence:CCGGGCCAGTCATGTAACTCTAGAACTCGAGTTCTAGAGTTACATGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-212s1c1
Sequence:CCGGGTTTATGCGTCTTAGGCATTACTCGAGTAATGCCTAAGACGCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-785s1c1
Sequence:CCGGGTACTTGAAACCACGCTGTAACTCGAGTTACAGCGTGGTTTCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_144638.1-305s1c1
Sequence:CCGGCCATTGCATCTGTCACAGTGACTCGAGTCACTGTGACAGATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025339
VALIDATED
TMEM42 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 42
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-377s1c1
Sequence:CCGGGAACATACTTTGCTCGGCCATCTCGAGATGGCCGAGCAAAGTATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-362s1c1
Sequence:CCGGCACAGTGACTTTCTCGAACATCTCGAGATGTTCGAGAAAGTCACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-325s1c1
Sequence:CCGGGCCTCAGTTTCTCTATGTCTTCTCGAGAAGACATAGAGAAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-293s1c1
Sequence:CCGGCAATTCTCTGATGTGGACCTTCTCGAGAAGGTCCACATCAGAGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-688s1c1
Sequence:CCGGGCCTGGAAAGTTAAAGCATTACTCGAGTAATGCTTTAACTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025339
VALIDATED
TMEM42 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 42
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-377s1c1
Sequence:CCGGGAACATACTTTGCTCGGCCATCTCGAGATGGCCGAGCAAAGTATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-362s1c1
Sequence:CCGGCACAGTGACTTTCTCGAACATCTCGAGATGTTCGAGAAAGTCACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-325s1c1
Sequence:CCGGGCCTCAGTTTCTCTATGTCTTCTCGAGAAGACATAGAGAAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-293s1c1
Sequence:CCGGCAATTCTCTGATGTGGACCTTCTCGAGAAGGTCCACATCAGAGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-688s1c1
Sequence:CCGGGCCTGGAAAGTTAAAGCATTACTCGAGTAATGCTTTAACTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025339
VALIDATED
TMEM42 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 42
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-377s1c1
Sequence:CCGGGAACATACTTTGCTCGGCCATCTCGAGATGGCCGAGCAAAGTATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-362s1c1
Sequence:CCGGCACAGTGACTTTCTCGAACATCTCGAGATGTTCGAGAAAGTCACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-325s1c1
Sequence:CCGGGCCTCAGTTTCTCTATGTCTTCTCGAGAAGACATAGAGAAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-293s1c1
Sequence:CCGGCAATTCTCTGATGTGGACCTTCTCGAGAAGGTCCACATCAGAGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025339.2-688s1c1
Sequence:CCGGGCCTGGAAAGTTAAAGCATTACTCGAGTAATGCTTTAACTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks