EMAIL THIS PAGE TO A FRIEND

TMEM43

transmembrane protein 43

Synonyms: ARVC5 ARVD5 EDMD7 LUMA
Gene ID:
Human(79188) Summary: This gene belongs to the TMEM43 family. Defects in this gene are the cause of familial arrhythmogenic right ventricular dysplasia type 5 (ARVD5), also known as arrhythmogenic right ventricular cardiomyopathy type 5 (ARVC5). Arrhythmogenic right ventricular dysplasia is an inherited disorder, often involving both ventricles, and is characterized by ventricular tachycardia, heart failure, sudden cardiac death, and fibrofatty replacement of cardiomyocytes. This gene contains a response element for PPAR gamma (an adipogenic transcription factor), which may explain the fibrofatty replacement of the myocardium, a characteristic pathological finding in ARVC. [provided by RefSeq, Oct 2008]
Mouse(74122) transmembrane protein 43
Rat(362401) transmembrane protein 43
Zebrafish(406520) transmembrane protein 43
chicken(416038) transmembrane protein 43
domestic cat(101080877) transmembrane protein 43
dog(484637) transmembrane protein 43
naked mole-rat(101708900) transmembrane protein 43
Domestic Rabbit(100346020) transmembrane protein 43
domestic guinea pig(100723606) transmembrane protein 43
cow(404066) transmembrane protein 43
sheep(101105535) transmembrane protein 43
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024334 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028766 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028766 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028766 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024334 Rosetta Predictions human pricing
NM_001007745 Rosetta Predictions rat pricing
NM_028766 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130391 predicted 301
2 SASI_Hs01_00130393 predicted 591
3 SASI_Hs01_00130394 predicted 590
4 SASI_Hs01_00130395 predicted 1668
5 SASI_Hs02_00356688 predicted 590
6 SASI_Hs01_00130396 predicted 1114
7 SASI_Hs01_00130397 predicted 569
8 SASI_Hs01_00130398 predicted 858
9 SASI_Hs02_00356689 predicted 579
10 SASI_Hs01_00130399 predicted 1799
11 SASI_Hs01_00130392 predicted 1588
12 SASI_Hs01_00130400 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112771 predicted 1346
2 SASI_Rn02_00198938 predicted 461
3 SASI_Rn01_00112772 predicted 1057
4 SASI_Rn01_00112773 predicted 535
5 SASI_Rn01_00112774 predicted 235
6 SASI_Rn01_00112775 predicted 468
7 SASI_Rn01_00112776 predicted 395
8 SASI_Rn01_00112777 predicted 663
9 SASI_Rn01_00112778 predicted 889
10 SASI_Rn01_00112779 predicted 414
11 SASI_Rn01_00112780 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056947 predicted 1577
2 SASI_Mm01_00056948 predicted 558
3 SASI_Mm01_00056949 predicted 1100
4 SASI_Mm01_00056950 predicted 362
5 SASI_Mm01_00056951 predicted 253
6 SASI_Mm01_00056952 predicted 468
7 SASI_Mm01_00056953 predicted 256
8 SASI_Mm01_00056954 predicted 712
9 SASI_Mm01_00056955 predicted 820
10 SASI_Mm01_00056956 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024334
TMEM43 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 43
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-507s1c1
Sequence:CCGGGAGATGTACCAATGGGTAGAACTCGAGTTCTACCCATTGGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024334.1-1121s1c1
Sequence:CCGGCCTTATGACACGGATCCTCTACTCGAGTAGAGGATCCGTGTCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-697s1c1
Sequence:CCGGCCTTTGTCCAAATTGGCAGGTCTCGAGACCTGCCAATTTGGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-1115s1c1
Sequence:CCGGCCTCAACCTTATGACACGGATCTCGAGATCCGTGTCATAAGGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-564s1c1
Sequence:CCGGGTGAAGAAGGAGACGAGGTATCTCGAGATACCTCGTCTCCTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-1032s1c1
Sequence:CCGGGAGGTGTTTCATAGAGAACTACTCGAGTAGTTCTCTATGAAACACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024334
TMEM43 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 43
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-507s1c1
Sequence:CCGGGAGATGTACCAATGGGTAGAACTCGAGTTCTACCCATTGGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024334.1-1121s1c1
Sequence:CCGGCCTTATGACACGGATCCTCTACTCGAGTAGAGGATCCGTGTCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-697s1c1
Sequence:CCGGCCTTTGTCCAAATTGGCAGGTCTCGAGACCTGCCAATTTGGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-1115s1c1
Sequence:CCGGCCTCAACCTTATGACACGGATCTCGAGATCCGTGTCATAAGGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-564s1c1
Sequence:CCGGGTGAAGAAGGAGACGAGGTATCTCGAGATACCTCGTCTCCTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-1032s1c1
Sequence:CCGGGAGGTGTTTCATAGAGAACTACTCGAGTAGTTCTCTATGAAACACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024334
TMEM43 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 43
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-507s1c1
Sequence:CCGGGAGATGTACCAATGGGTAGAACTCGAGTTCTACCCATTGGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024334.1-1121s1c1
Sequence:CCGGCCTTATGACACGGATCCTCTACTCGAGTAGAGGATCCGTGTCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-697s1c1
Sequence:CCGGCCTTTGTCCAAATTGGCAGGTCTCGAGACCTGCCAATTTGGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-1115s1c1
Sequence:CCGGCCTCAACCTTATGACACGGATCTCGAGATCCGTGTCATAAGGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-564s1c1
Sequence:CCGGGTGAAGAAGGAGACGAGGTATCTCGAGATACCTCGTCTCCTTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024334.1-1032s1c1
Sequence:CCGGGAGGTGTTTCATAGAGAACTACTCGAGTAGTTCTCTATGAAACACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028766
VALIDATED
TMEM43 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 43
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028766.1-943s1c1
Sequence:CCGGGTGACCAACTAATCCCATATTCTCGAGAATATGGGATTAGTTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028766.1-1164s1c1
Sequence:CCGGCTTGTCAACATTGGCCTGAAACTCGAGTTTCAGGCCAATGTTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028766.1-434s1c1
Sequence:CCGGGCTCTTGTCTGACCCAAATTACTCGAGTAATTTGGGTCAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028766.1-1029s1c1
Sequence:CCGGCGTAGAGAACAGAAGAGCAATCTCGAGATTGCTCTTCTGTTCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028766.1-2615s1c1
Sequence:CCGGGCTGGTACAATCTCTTAGAAACTCGAGTTTCTAAGAGATTGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-942s21c1
Sequence:CCGGGTGACCAACTAATCCCATATTCTCGAGAATATGGGATTAGTTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-433s21c1
Sequence:CCGGGCTCTTGTCTGACCCAAATTACTCGAGTAATTTGGGTCAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-1747s21c1
Sequence:CCGGGGACAGAGTGCTTCGGTATAACTCGAGTTATACCGAAGCACTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-369s21c1
Sequence:CCGGATAGTGTAGCTCCGGAGAATGCTCGAGCATTCTCCGGAGCTACACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-1028s21c1
Sequence:CCGGCGTAGAGAACAGAAGAGCAATCTCGAGATTGCTCTTCTGTTCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028766
VALIDATED
TMEM43 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 43
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028766.1-943s1c1
Sequence:CCGGGTGACCAACTAATCCCATATTCTCGAGAATATGGGATTAGTTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028766.1-1164s1c1
Sequence:CCGGCTTGTCAACATTGGCCTGAAACTCGAGTTTCAGGCCAATGTTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028766.1-434s1c1
Sequence:CCGGGCTCTTGTCTGACCCAAATTACTCGAGTAATTTGGGTCAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028766.1-1029s1c1
Sequence:CCGGCGTAGAGAACAGAAGAGCAATCTCGAGATTGCTCTTCTGTTCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028766.1-2615s1c1
Sequence:CCGGGCTGGTACAATCTCTTAGAAACTCGAGTTTCTAAGAGATTGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-942s21c1
Sequence:CCGGGTGACCAACTAATCCCATATTCTCGAGAATATGGGATTAGTTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-433s21c1
Sequence:CCGGGCTCTTGTCTGACCCAAATTACTCGAGTAATTTGGGTCAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-1747s21c1
Sequence:CCGGGGACAGAGTGCTTCGGTATAACTCGAGTTATACCGAAGCACTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-369s21c1
Sequence:CCGGATAGTGTAGCTCCGGAGAATGCTCGAGCATTCTCCGGAGCTACACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-1028s21c1
Sequence:CCGGCGTAGAGAACAGAAGAGCAATCTCGAGATTGCTCTTCTGTTCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028766
VALIDATED
TMEM43 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 43
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028766.1-943s1c1
Sequence:CCGGGTGACCAACTAATCCCATATTCTCGAGAATATGGGATTAGTTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028766.1-1164s1c1
Sequence:CCGGCTTGTCAACATTGGCCTGAAACTCGAGTTTCAGGCCAATGTTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028766.1-434s1c1
Sequence:CCGGGCTCTTGTCTGACCCAAATTACTCGAGTAATTTGGGTCAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028766.1-1029s1c1
Sequence:CCGGCGTAGAGAACAGAAGAGCAATCTCGAGATTGCTCTTCTGTTCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028766.1-2615s1c1
Sequence:CCGGGCTGGTACAATCTCTTAGAAACTCGAGTTTCTAAGAGATTGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-942s21c1
Sequence:CCGGGTGACCAACTAATCCCATATTCTCGAGAATATGGGATTAGTTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-433s21c1
Sequence:CCGGGCTCTTGTCTGACCCAAATTACTCGAGTAATTTGGGTCAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-1747s21c1
Sequence:CCGGGGACAGAGTGCTTCGGTATAACTCGAGTTATACCGAAGCACTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-369s21c1
Sequence:CCGGATAGTGTAGCTCCGGAGAATGCTCGAGCATTCTCCGGAGCTACACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028766.2-1028s21c1
Sequence:CCGGCGTAGAGAACAGAAGAGCAATCTCGAGATTGCTCTTCTGTTCTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks