EMAIL THIS PAGE TO A FRIEND

TMEM44

transmembrane protein 44

Gene ID:
Mouse(224090) transmembrane protein 44
Rat(288028) transmembrane protein 44
cow(614057) transmembrane protein 44
sheep(101102868) transmembrane protein 44
domestic guinea pig(100718798) transmembrane protein 44
Zebrafish(751636) transmembrane protein 44
domestic cat(101089956) transmembrane protein 44
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043718 Anti-TMEM44 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138399 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091951 MISSION® esiRNA esiRNA human TMEM44 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011655 Rosetta Predictions human pricing
NM_138399 Rosetta Predictions human pricing
XM_001062650 Rosetta Predictions rat pricing
XM_213600 Rosetta Predictions rat pricing
NM_172614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226669 predicted 495
2 SASI_Hs01_00226670 predicted 1105
3 SASI_Hs01_00226672 predicted 1727
4 SASI_Hs01_00226673 predicted 1821
5 SASI_Hs01_00226674 predicted 1947
6 SASI_Hs01_00226675 predicted 1807
7 SASI_Hs01_00226678 predicted 515
8 SASI_Hs02_00306003 predicted 1721
9 SASI_Hs02_00306004 predicted 984
10 SASI_Hs02_00306005 predicted 445
11 SASI_Hs01_00226671 predicted 1800
12 SASI_Hs01_00226676 predicted 563
13 SASI_Hs01_00226677 predicted 1595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028978 predicted 492
2 SASI_Hs01_00028979 predicted 1113
3 SASI_Hs01_00028981 predicted 1755
4 SASI_Hs01_00028982 predicted 1851
5 SASI_Hs01_00028983 predicted 1980
6 SASI_Hs01_00028984 predicted 1839
7 SASI_Hs01_00028987 predicted 513
8 SASI_Hs02_00363540 predicted 1755
9 SASI_Hs02_00363541 predicted 977
10 SASI_Hs02_00363542 predicted 452
11 SASI_Hs01_00028980 predicted 1830
12 SASI_Hs01_00028985 predicted 565
13 SASI_Hs01_00028986 predicted 1628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304109 predicted 466
2 SASI_Rn02_00304110 predicted 614
3 SASI_Rn02_00304111 predicted 1026
4 SASI_Rn02_00304112 predicted 721
5 SASI_Rn02_00304113 predicted 1173
6 SASI_Rn02_00304114 predicted 649
7 SASI_Rn02_00304115 predicted 1182
8 SASI_Rn02_00304116 predicted 1301
9 SASI_Rn02_00304117 predicted 1127
10 SASI_Rn02_00304118 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374756 predicted 1256
2 SASI_Rn02_00374757 predicted 1254
3 SASI_Rn02_00374758 predicted 1158
4 SASI_Rn02_00374759 predicted 1182
5 SASI_Rn02_00374760 predicted 1180
6 SASI_Rn02_00374761 predicted 1306
7 SASI_Rn02_00374762 predicted 1123
8 SASI_Rn02_00374763 predicted 1304
9 SASI_Rn02_00374764 predicted 1206
10 SASI_Rn02_00374765 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067024 predicted 898
2 SASI_Mm01_00067025 predicted 1280
3 SASI_Mm01_00067026 predicted 771
4 SASI_Mm01_00067027 predicted 355
5 SASI_Mm01_00067029 predicted 206
6 SASI_Mm01_00067030 predicted 1359
7 SASI_Mm01_00067032 predicted 1077
8 SASI_Mm01_00067033 predicted 379
9 SASI_Mm02_00344320 predicted 1467
10 SASI_Mm02_00344321 predicted 234
11 SASI_Mm01_00067028 predicted 1276
12 SASI_Mm01_00067031 predicted 222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172614
TMEM44 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 44
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172614.3-358s21c1
Sequence:CCGGCTACCTAGCAGCTGTCGATTTCTCGAGAAATCGACAGCTGCTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172614.3-865s21c1
Sequence:CCGGCTTTCTGTCCTGCGTGATAAACTCGAGTTTATCACGCAGGACAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172614.3-2966s21c1
Sequence:CCGGGATGAGGACACACGTTTAAATCTCGAGATTTAAACGTGTGTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172614.3-667s21c1
Sequence:CCGGGATCCCTCCATTCTCCAATATCTCGAGATATTGGAGAATGGAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172614.3-778s21c1
Sequence:CCGGTCATGACCGGCAGCCTGAATACTCGAGTATTCAGGCTGCCGGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172614.2-2784s1c1
Sequence:CCGGGCTGGCATTTCCAAGTTCCTACTCGAGTAGGAACTTGGAAATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172614
TMEM44 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 44
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172614.3-358s21c1
Sequence:CCGGCTACCTAGCAGCTGTCGATTTCTCGAGAAATCGACAGCTGCTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172614.3-865s21c1
Sequence:CCGGCTTTCTGTCCTGCGTGATAAACTCGAGTTTATCACGCAGGACAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172614.3-2966s21c1
Sequence:CCGGGATGAGGACACACGTTTAAATCTCGAGATTTAAACGTGTGTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172614.3-667s21c1
Sequence:CCGGGATCCCTCCATTCTCCAATATCTCGAGATATTGGAGAATGGAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172614.3-778s21c1
Sequence:CCGGTCATGACCGGCAGCCTGAATACTCGAGTATTCAGGCTGCCGGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172614.2-2784s1c1
Sequence:CCGGGCTGGCATTTCCAAGTTCCTACTCGAGTAGGAACTTGGAAATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172614
TMEM44 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 44
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172614.3-358s21c1
Sequence:CCGGCTACCTAGCAGCTGTCGATTTCTCGAGAAATCGACAGCTGCTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172614.3-865s21c1
Sequence:CCGGCTTTCTGTCCTGCGTGATAAACTCGAGTTTATCACGCAGGACAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172614.3-2966s21c1
Sequence:CCGGGATGAGGACACACGTTTAAATCTCGAGATTTAAACGTGTGTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172614.3-667s21c1
Sequence:CCGGGATCCCTCCATTCTCCAATATCTCGAGATATTGGAGAATGGAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172614.3-778s21c1
Sequence:CCGGTCATGACCGGCAGCCTGAATACTCGAGTATTCAGGCTGCCGGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172614.2-2784s1c1
Sequence:CCGGGCTGGCATTTCCAAGTTCCTACTCGAGTAGGAACTTGGAAATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138399
TMEM44 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 44
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-864s1c1
Sequence:CCGGGTGTGTGATGAAGAGCAAGATCTCGAGATCTTGCTCTTCATCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138399.2-1245s1c1
Sequence:CCGGGAAGTATTGGGAGGCCCTAAACTCGAGTTTAGGGCCTCCCAATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-1035s1c1
Sequence:CCGGGACAGCAATCAGTCGCTACATCTCGAGATGTAGCGACTGATTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-835s1c1
Sequence:CCGGGCACTGGACCTCGCTATTATTCTCGAGAATAATAGCGAGGTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138399.2-1014s1c1
Sequence:CCGGCTGCAAGTCACTGAGGACAATCTCGAGATTGTCCTCAGTGACTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138399.2-687s1c1
Sequence:CCGGGAAGACATTTCCCTCCATCCACTCGAGTGGATGGAGGGAAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138399.2-314s1c1
Sequence:CCGGGACAGCTCACAATCCAGGTTTCTCGAGAAACCTGGATTGTGAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-348s1c1
Sequence:CCGGCCTAGCAGCTATTGACTTAGTCTCGAGACTAAGTCAATAGCTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-200s1c1
Sequence:CCGGCGCTGCTTCTCTATCTGAGATCTCGAGATCTCAGATAGAGAAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138399
TMEM44 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 44
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-864s1c1
Sequence:CCGGGTGTGTGATGAAGAGCAAGATCTCGAGATCTTGCTCTTCATCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138399.2-1245s1c1
Sequence:CCGGGAAGTATTGGGAGGCCCTAAACTCGAGTTTAGGGCCTCCCAATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-1035s1c1
Sequence:CCGGGACAGCAATCAGTCGCTACATCTCGAGATGTAGCGACTGATTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-835s1c1
Sequence:CCGGGCACTGGACCTCGCTATTATTCTCGAGAATAATAGCGAGGTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138399.2-1014s1c1
Sequence:CCGGCTGCAAGTCACTGAGGACAATCTCGAGATTGTCCTCAGTGACTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138399.2-687s1c1
Sequence:CCGGGAAGACATTTCCCTCCATCCACTCGAGTGGATGGAGGGAAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138399.2-314s1c1
Sequence:CCGGGACAGCTCACAATCCAGGTTTCTCGAGAAACCTGGATTGTGAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-348s1c1
Sequence:CCGGCCTAGCAGCTATTGACTTAGTCTCGAGACTAAGTCAATAGCTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-200s1c1
Sequence:CCGGCGCTGCTTCTCTATCTGAGATCTCGAGATCTCAGATAGAGAAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138399
TMEM44 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 44
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-864s1c1
Sequence:CCGGGTGTGTGATGAAGAGCAAGATCTCGAGATCTTGCTCTTCATCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138399.2-1245s1c1
Sequence:CCGGGAAGTATTGGGAGGCCCTAAACTCGAGTTTAGGGCCTCCCAATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-1035s1c1
Sequence:CCGGGACAGCAATCAGTCGCTACATCTCGAGATGTAGCGACTGATTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-835s1c1
Sequence:CCGGGCACTGGACCTCGCTATTATTCTCGAGAATAATAGCGAGGTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138399.2-1014s1c1
Sequence:CCGGCTGCAAGTCACTGAGGACAATCTCGAGATTGTCCTCAGTGACTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138399.2-687s1c1
Sequence:CCGGGAAGACATTTCCCTCCATCCACTCGAGTGGATGGAGGGAAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138399.2-314s1c1
Sequence:CCGGGACAGCTCACAATCCAGGTTTCTCGAGAAACCTGGATTGTGAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-348s1c1
Sequence:CCGGCCTAGCAGCTATTGACTTAGTCTCGAGACTAAGTCAATAGCTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138399.2-200s1c1
Sequence:CCGGCGCTGCTTCTCTATCTGAGATCTCGAGATCTCAGATAGAGAAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks