EMAIL THIS PAGE TO A FRIEND

TMEM45A

transmembrane protein 45A

Synonyms: DERP7
UniProtKB ID: Q9NWC5, Q53YW5
Gene ID:
Mouse(56277) transmembrane protein 45a
Rat(680866) transmembrane protein 45A
chicken(418389) transmembrane protein 45A
domestic cat(101093796) transmembrane protein 45A
dog(478543) transmembrane protein 45A
naked mole-rat(101715851) transmembrane protein 45A
cow(509461) transmembrane protein 45A
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018004 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131001 MISSION® esiRNA esiRNA human TMEM45A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018004 Rosetta Predictions human pricing
XM_001059246 Rosetta Predictions rat pricing
NM_019631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033792 predicted 376
2 SASI_Hs02_00351077 predicted 1132
3 SASI_Hs01_00033793 predicted 1239
4 SASI_Hs01_00033794 predicted 741
5 SASI_Hs01_00033795 predicted 701
6 SASI_Hs02_00351078 predicted 889
7 SASI_Hs02_00351079 predicted 699
8 SASI_Hs02_00351080 predicted 359
9 SASI_Hs01_00033797 predicted 836
10 SASI_Hs01_00033799 predicted 829
11 SASI_Hs01_00033796 predicted 994
12 SASI_Hs01_00033798 predicted 1044
13 SASI_Hs01_00033800 predicted 488
14 SASI_Hs01_00033801 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292598 predicted 699
2 SASI_Rn02_00292599 predicted 680
3 SASI_Rn02_00292600 predicted 1171
4 SASI_Rn02_00292601 predicted 1186
5 SASI_Rn02_00292602 predicted 1148
6 SASI_Rn02_00292603 predicted 829
7 SASI_Rn02_00292604 predicted 638
8 SASI_Rn02_00292605 predicted 1021
9 SASI_Rn02_00292606 predicted 1121
10 SASI_Rn02_00292607 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055817 predicted 621
2 SASI_Mm01_00055818 predicted 708
3 SASI_Mm02_00324662 predicted 490
4 SASI_Mm01_00055819 predicted 669
5 SASI_Mm01_00055820 predicted 418
6 SASI_Mm01_00055821 predicted 538
7 SASI_Mm01_00055822 predicted 721
8 SASI_Mm01_00055823 predicted 639
9 SASI_Mm01_00055824 predicted 700
10 SASI_Mm01_00055825 predicted 659
11 SASI_Mm01_00055816 predicted 1182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018004
VALIDATED
TMEM45A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 45A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018004.1-1001s1c1
Sequence:CCGGGCAGTAACCATTGTCATCGTTCTCGAGAACGATGACAATGGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018004.1-821s1c1
Sequence:CCGGGAGTTCCTTGTTCGGAACAATCTCGAGATTGTTCCGAACAAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018004.1-1034s1c1
Sequence:CCGGGCTTTCATTACCTGGTTGGTTCTCGAGAACCAACCAGGTAATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018004.1-889s1c1
Sequence:CCGGCTGGTTCTTTCAGATTGGATTCTCGAGAATCCAATCTGAAAGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018004.1-1109s1c1
Sequence:CCGGGAACGAGAACAAGAATCAGAACTCGAGTTCTGATTCTTGTTCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018004.1-1240s1c1
Sequence:CCGGGATGACTCTAAGTGTACTGTTCTCGAGAACAGTACACTTAGAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018004.1-668s1c1
Sequence:CCGGCCTGTGTCCTTAACCAAGTTACTCGAGTAACTTGGTTAAGGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018004.1-1001s21c1
Sequence:CCGGGCAGTAACCATTGTCATCGTTCTCGAGAACGATGACAATGGTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018004.1-668s21c1
Sequence:CCGGCCTGTGTCCTTAACCAAGTTACTCGAGTAACTTGGTTAAGGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018004.1-821s21c1
Sequence:CCGGGAGTTCCTTGTTCGGAACAATCTCGAGATTGTTCCGAACAAGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018004.1-1240s21c1
Sequence:CCGGGATGACTCTAAGTGTACTGTTCTCGAGAACAGTACACTTAGAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018004.1-1109s21c1
Sequence:CCGGGAACGAGAACAAGAATCAGAACTCGAGTTCTGATTCTTGTTCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018004
VALIDATED
TMEM45A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 45A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018004.1-1001s1c1
Sequence:CCGGGCAGTAACCATTGTCATCGTTCTCGAGAACGATGACAATGGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018004.1-821s1c1
Sequence:CCGGGAGTTCCTTGTTCGGAACAATCTCGAGATTGTTCCGAACAAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018004.1-1034s1c1
Sequence:CCGGGCTTTCATTACCTGGTTGGTTCTCGAGAACCAACCAGGTAATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018004.1-889s1c1
Sequence:CCGGCTGGTTCTTTCAGATTGGATTCTCGAGAATCCAATCTGAAAGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018004.1-1109s1c1
Sequence:CCGGGAACGAGAACAAGAATCAGAACTCGAGTTCTGATTCTTGTTCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018004.1-1240s1c1
Sequence:CCGGGATGACTCTAAGTGTACTGTTCTCGAGAACAGTACACTTAGAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018004.1-668s1c1
Sequence:CCGGCCTGTGTCCTTAACCAAGTTACTCGAGTAACTTGGTTAAGGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018004.1-1001s21c1
Sequence:CCGGGCAGTAACCATTGTCATCGTTCTCGAGAACGATGACAATGGTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018004.1-668s21c1
Sequence:CCGGCCTGTGTCCTTAACCAAGTTACTCGAGTAACTTGGTTAAGGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018004.1-821s21c1
Sequence:CCGGGAGTTCCTTGTTCGGAACAATCTCGAGATTGTTCCGAACAAGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018004.1-1240s21c1
Sequence:CCGGGATGACTCTAAGTGTACTGTTCTCGAGAACAGTACACTTAGAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018004.1-1109s21c1
Sequence:CCGGGAACGAGAACAAGAATCAGAACTCGAGTTCTGATTCTTGTTCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018004
VALIDATED
TMEM45A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 45A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018004.1-1001s1c1
Sequence:CCGGGCAGTAACCATTGTCATCGTTCTCGAGAACGATGACAATGGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018004.1-821s1c1
Sequence:CCGGGAGTTCCTTGTTCGGAACAATCTCGAGATTGTTCCGAACAAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018004.1-1034s1c1
Sequence:CCGGGCTTTCATTACCTGGTTGGTTCTCGAGAACCAACCAGGTAATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018004.1-889s1c1
Sequence:CCGGCTGGTTCTTTCAGATTGGATTCTCGAGAATCCAATCTGAAAGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018004.1-1109s1c1
Sequence:CCGGGAACGAGAACAAGAATCAGAACTCGAGTTCTGATTCTTGTTCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018004.1-1240s1c1
Sequence:CCGGGATGACTCTAAGTGTACTGTTCTCGAGAACAGTACACTTAGAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018004.1-668s1c1
Sequence:CCGGCCTGTGTCCTTAACCAAGTTACTCGAGTAACTTGGTTAAGGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018004.1-1001s21c1
Sequence:CCGGGCAGTAACCATTGTCATCGTTCTCGAGAACGATGACAATGGTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018004.1-668s21c1
Sequence:CCGGCCTGTGTCCTTAACCAAGTTACTCGAGTAACTTGGTTAAGGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018004.1-821s21c1
Sequence:CCGGGAGTTCCTTGTTCGGAACAATCTCGAGATTGTTCCGAACAAGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018004.1-1240s21c1
Sequence:CCGGGATGACTCTAAGTGTACTGTTCTCGAGAACAGTACACTTAGAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018004.1-1109s21c1
Sequence:CCGGGAACGAGAACAAGAATCAGAACTCGAGTTCTGATTCTTGTTCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019631
VALIDATED
TMEM45A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 45A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019631.2-672s1c1
Sequence:CCGGCCCAAATCATATGTTTCACTACTCGAGTAGTGAAACATATGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019631.2-1037s1c1
Sequence:CCGGGCATCAATCCTTATCCTCATTCTCGAGAATGAGGATAAGGATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019631.2-1385s1c1
Sequence:CCGGGCCATGTAATTCAAGACCAATCTCGAGATTGGTCTTGAATTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019631.2-578s1c1
Sequence:CCGGCCTGCCTTGATCTTGCATAAACTCGAGTTTATGCAAGATCAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019631.2-778s1c1
Sequence:CCGGCGGTCGGGAAATGATTGACATCTCGAGATGTCAATCATTTCCCGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019631.3-530s21c1
Sequence:CCGGTAATGTCTCTCACTGGTATAGCTCGAGCTATACCAGTGAGAGACATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019631.3-1044s21c1
Sequence:CCGGCCTTATCCTCATTGGAGTAAACTCGAGTTTACTCCAATGAGGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019631.3-457s21c1
Sequence:CCGGACTCGAACCTGCTACCTTAACCTCGAGGTTAAGGTAGCAGGTTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019631.3-651s21c1
Sequence:CCGGCTTTGGGCTACAGGGTATAACCTCGAGGTTATACCCTGTAGCCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019631.3-1384s21c1
Sequence:CCGGGCCATGTAATTCAAGACCAATCTCGAGATTGGTCTTGAATTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019631
VALIDATED
TMEM45A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 45A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019631.2-672s1c1
Sequence:CCGGCCCAAATCATATGTTTCACTACTCGAGTAGTGAAACATATGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019631.2-1037s1c1
Sequence:CCGGGCATCAATCCTTATCCTCATTCTCGAGAATGAGGATAAGGATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019631.2-1385s1c1
Sequence:CCGGGCCATGTAATTCAAGACCAATCTCGAGATTGGTCTTGAATTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019631.2-578s1c1
Sequence:CCGGCCTGCCTTGATCTTGCATAAACTCGAGTTTATGCAAGATCAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019631.2-778s1c1
Sequence:CCGGCGGTCGGGAAATGATTGACATCTCGAGATGTCAATCATTTCCCGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019631.3-530s21c1
Sequence:CCGGTAATGTCTCTCACTGGTATAGCTCGAGCTATACCAGTGAGAGACATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019631.3-1044s21c1
Sequence:CCGGCCTTATCCTCATTGGAGTAAACTCGAGTTTACTCCAATGAGGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019631.3-457s21c1
Sequence:CCGGACTCGAACCTGCTACCTTAACCTCGAGGTTAAGGTAGCAGGTTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019631.3-651s21c1
Sequence:CCGGCTTTGGGCTACAGGGTATAACCTCGAGGTTATACCCTGTAGCCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019631.3-1384s21c1
Sequence:CCGGGCCATGTAATTCAAGACCAATCTCGAGATTGGTCTTGAATTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019631
VALIDATED
TMEM45A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 45A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019631.2-672s1c1
Sequence:CCGGCCCAAATCATATGTTTCACTACTCGAGTAGTGAAACATATGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019631.2-1037s1c1
Sequence:CCGGGCATCAATCCTTATCCTCATTCTCGAGAATGAGGATAAGGATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019631.2-1385s1c1
Sequence:CCGGGCCATGTAATTCAAGACCAATCTCGAGATTGGTCTTGAATTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019631.2-578s1c1
Sequence:CCGGCCTGCCTTGATCTTGCATAAACTCGAGTTTATGCAAGATCAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019631.2-778s1c1
Sequence:CCGGCGGTCGGGAAATGATTGACATCTCGAGATGTCAATCATTTCCCGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019631.3-530s21c1
Sequence:CCGGTAATGTCTCTCACTGGTATAGCTCGAGCTATACCAGTGAGAGACATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019631.3-1044s21c1
Sequence:CCGGCCTTATCCTCATTGGAGTAAACTCGAGTTTACTCCAATGAGGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019631.3-457s21c1
Sequence:CCGGACTCGAACCTGCTACCTTAACCTCGAGGTTAAGGTAGCAGGTTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019631.3-651s21c1
Sequence:CCGGCTTTGGGCTACAGGGTATAACCTCGAGGTTATACCCTGTAGCCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019631.3-1384s21c1
Sequence:CCGGGCCATGTAATTCAAGACCAATCTCGAGATTGGTCTTGAATTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks