EMAIL THIS PAGE TO A FRIEND

TMEM45B

transmembrane protein 45B

UniProtKB ID: Q96B21, A8K2L8
Gene ID:
Mouse(235135) transmembrane protein 45b
Rat(315524) transmembrane protein 45b
cow(510305) transmembrane protein 45B
sheep(101118569) transmembrane protein 45B
naked mole-rat(101726353) transmembrane protein 45B
domestic guinea pig(100733426) transmembrane protein 45B
Zebrafish(402977) transmembrane protein 45B
domestic cat(101092209) transmembrane protein 45B
dog(479394) transmembrane protein 45B
chicken(419725) transmembrane protein 45B
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144936 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144936 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144936 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138788 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138788 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138788 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138788 Rosetta Predictions human pricing
NM_001033067 Rosetta Predictions rat pricing
NM_144936 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042354 predicted 526
2 SASI_Hs01_00042355 predicted 413
3 SASI_Hs01_00042356 predicted 564
4 SASI_Hs01_00042357 predicted 828
5 SASI_Hs01_00042358 predicted 1128
6 SASI_Hs02_00363920 predicted 544
7 SASI_Hs01_00042359 predicted 803
8 SASI_Hs01_00042360 predicted 744
9 SASI_Hs02_00363921 predicted 1104
10 SASI_Hs02_00363922 predicted 1100
11 SASI_Hs01_00042352 predicted 1178
12 SASI_Hs01_00042353 predicted 340
13 SASI_Hs01_00042361 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088242 predicted 981
2 SASI_Rn01_00088243 predicted 410
3 SASI_Rn01_00088244 predicted 297
4 SASI_Rn01_00088245 predicted 982
5 SASI_Rn01_00088246 predicted 545
6 SASI_Rn02_00203626 predicted 293
7 SASI_Rn01_00088247 predicted 1130
8 SASI_Rn01_00088249 predicted 1018
9 SASI_Rn02_00203627 predicted 304
10 SASI_Rn02_00203628 predicted 735
11 SASI_Rn01_00088248 predicted 703
12 SASI_Rn01_00088250 predicted 715
13 SASI_Rn01_00088251 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195289 predicted 1186
2 SASI_Mm01_00195290 predicted 1112
3 SASI_Mm01_00195291 predicted 630
4 SASI_Mm01_00195292 predicted 584
5 SASI_Mm02_00340461 predicted 841
6 SASI_Mm01_00195294 predicted 725
7 SASI_Mm01_00195295 predicted 1343
8 SASI_Mm01_00195296 predicted 1257
9 SASI_Mm01_00195297 predicted 466
10 SASI_Mm01_00195298 predicted 1146
11 SASI_Mm01_00195293 predicted 996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144936
TMEM45B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 45B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144936.1-576s21c1
Sequence:CCGGAGCATCTCTCTGGAGGTTATCCTCGAGGATAACCTCCAGAGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144936.1-1392s21c1
Sequence:CCGGATCACGTGCTGCTTCTGATAACTCGAGTTATCAGAAGCAGCACGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144936.1-253s21c1
Sequence:CCGGAGACTCTGTTTGCAATCATTGCTCGAGCAATGATTGCAAACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144936.1-676s21c1
Sequence:CCGGTTGTCCTGTTCCCGCCATTTGCTCGAGCAAATGGCGGGAACAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144936.1-1127s21c1
Sequence:CCGGGTGCTCCTAGGGCTCTATATGCTCGAGCATATAGAGCCCTAGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144936.1-624s21c1
Sequence:CCGGTTCCGAACCAGTCTCCTTATCCTCGAGGATAAGGAGACTGGTTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144936.1-1436s1c1
Sequence:CCGGGCAGGTACTTTCTTCTCAGAACTCGAGTTCTGAGAAGAAAGTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144936.1-789s1c1
Sequence:CCGGGCCATCAACTACTCCCTTGTTCTCGAGAACAAGGGAGTAGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144936
TMEM45B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 45B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144936.1-576s21c1
Sequence:CCGGAGCATCTCTCTGGAGGTTATCCTCGAGGATAACCTCCAGAGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144936.1-1392s21c1
Sequence:CCGGATCACGTGCTGCTTCTGATAACTCGAGTTATCAGAAGCAGCACGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144936.1-253s21c1
Sequence:CCGGAGACTCTGTTTGCAATCATTGCTCGAGCAATGATTGCAAACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144936.1-676s21c1
Sequence:CCGGTTGTCCTGTTCCCGCCATTTGCTCGAGCAAATGGCGGGAACAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144936.1-1127s21c1
Sequence:CCGGGTGCTCCTAGGGCTCTATATGCTCGAGCATATAGAGCCCTAGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144936.1-624s21c1
Sequence:CCGGTTCCGAACCAGTCTCCTTATCCTCGAGGATAAGGAGACTGGTTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144936.1-1436s1c1
Sequence:CCGGGCAGGTACTTTCTTCTCAGAACTCGAGTTCTGAGAAGAAAGTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144936.1-789s1c1
Sequence:CCGGGCCATCAACTACTCCCTTGTTCTCGAGAACAAGGGAGTAGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144936
TMEM45B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 45B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144936.1-576s21c1
Sequence:CCGGAGCATCTCTCTGGAGGTTATCCTCGAGGATAACCTCCAGAGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144936.1-1392s21c1
Sequence:CCGGATCACGTGCTGCTTCTGATAACTCGAGTTATCAGAAGCAGCACGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144936.1-253s21c1
Sequence:CCGGAGACTCTGTTTGCAATCATTGCTCGAGCAATGATTGCAAACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144936.1-676s21c1
Sequence:CCGGTTGTCCTGTTCCCGCCATTTGCTCGAGCAAATGGCGGGAACAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144936.1-1127s21c1
Sequence:CCGGGTGCTCCTAGGGCTCTATATGCTCGAGCATATAGAGCCCTAGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144936.1-624s21c1
Sequence:CCGGTTCCGAACCAGTCTCCTTATCCTCGAGGATAAGGAGACTGGTTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144936.1-1436s1c1
Sequence:CCGGGCAGGTACTTTCTTCTCAGAACTCGAGTTCTGAGAAGAAAGTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144936.1-789s1c1
Sequence:CCGGGCCATCAACTACTCCCTTGTTCTCGAGAACAAGGGAGTAGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138788
TMEM45B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 45B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138788.3-198s21c1
Sequence:CCGGAGATCGTCGAAGCCGCAATTACTCGAGTAATTGCGGCTTCGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138788.3-418s21c1
Sequence:CCGGGGTTATGGCTGTGGCAGTATTCTCGAGAATACTGCCACAGCCATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138788.3-972s21c1
Sequence:CCGGGTCTGATCTTAAGGGTCTATACTCGAGTATAGACCCTTAAGATCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138788.3-93s21c1
Sequence:CCGGGGAGTTTCTTCCTGATCATTGCTCGAGCAATGATCAGGAAGAAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138788.3-744s21c1
Sequence:CCGGGCATTGTGGCCGTCAACTATTCTCGAGAATAGTTGACGGCCACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167511    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138788.2-1297s1c1
Sequence:CCGGGCAGGTACTTTCTTATTAGAACTCGAGTTCTAATAAGAAAGTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138788.2-1762s1c1
Sequence:CCGGGCGCCTATAATCCTAGCACTTCTCGAGAAGTGCTAGGATTATAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138788
TMEM45B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 45B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138788.3-198s21c1
Sequence:CCGGAGATCGTCGAAGCCGCAATTACTCGAGTAATTGCGGCTTCGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138788.3-418s21c1
Sequence:CCGGGGTTATGGCTGTGGCAGTATTCTCGAGAATACTGCCACAGCCATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138788.3-972s21c1
Sequence:CCGGGTCTGATCTTAAGGGTCTATACTCGAGTATAGACCCTTAAGATCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138788.3-93s21c1
Sequence:CCGGGGAGTTTCTTCCTGATCATTGCTCGAGCAATGATCAGGAAGAAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138788.3-744s21c1
Sequence:CCGGGCATTGTGGCCGTCAACTATTCTCGAGAATAGTTGACGGCCACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167511    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138788.2-1297s1c1
Sequence:CCGGGCAGGTACTTTCTTATTAGAACTCGAGTTCTAATAAGAAAGTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138788.2-1762s1c1
Sequence:CCGGGCGCCTATAATCCTAGCACTTCTCGAGAAGTGCTAGGATTATAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138788
TMEM45B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 45B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138788.3-198s21c1
Sequence:CCGGAGATCGTCGAAGCCGCAATTACTCGAGTAATTGCGGCTTCGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138788.3-418s21c1
Sequence:CCGGGGTTATGGCTGTGGCAGTATTCTCGAGAATACTGCCACAGCCATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138788.3-972s21c1
Sequence:CCGGGTCTGATCTTAAGGGTCTATACTCGAGTATAGACCCTTAAGATCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138788.3-93s21c1
Sequence:CCGGGGAGTTTCTTCCTGATCATTGCTCGAGCAATGATCAGGAAGAAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138788.3-744s21c1
Sequence:CCGGGCATTGTGGCCGTCAACTATTCTCGAGAATAGTTGACGGCCACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167511    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138788.2-1297s1c1
Sequence:CCGGGCAGGTACTTTCTTATTAGAACTCGAGTTCTAATAAGAAAGTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138788.2-1762s1c1
Sequence:CCGGGCGCCTATAATCCTAGCACTTCTCGAGAAGTGCTAGGATTATAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks