EMAIL THIS PAGE TO A FRIEND

TMEM47

transmembrane protein 47

Synonyms: BCMP1 TM4SF10
UniProtKB ID: Q9BQJ4, Q5JR44
Gene ID:
Human(83604) Summary: This gene encodes a member of the PMP22/EMP/claudin protein family. The encoded protein is localized to the ER and the plasma membrane. In dogs, transcripts of this gene exist at high levels in the brain. [provided by RefSeq, Jul 2008]
Mouse(192216) transmembrane protein 47
Rat(501569) transmembrane protein 47
Zebrafish(406640) transmembrane protein 47
dog(403572) transmembrane protein 47
domestic cat(101100625) transmembrane protein 47
chicken(418585) transmembrane protein 47
cow(541164) transmembrane protein 47
235 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031442 Rosetta Predictions human pricing
NM_001109317 Rosetta Predictions rat pricing
NM_138751 Rosetta Predictions mouse pricing
NM_175771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112564 predicted 491
2 SASI_Hs01_00112565 predicted 786
3 SASI_Hs01_00112566 predicted 1090
4 SASI_Hs01_00112567 predicted 490
5 SASI_Hs01_00112568 predicted 1092
6 SASI_Hs01_00112569 predicted 642
7 SASI_Hs01_00112570 predicted 799
8 SASI_Hs01_00112571 predicted 983
9 SASI_Hs01_00112572 predicted 1005
10 SASI_Hs01_00112573 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247234 predicted 1245
2 SASI_Rn02_00247235 predicted 445
3 SASI_Rn02_00247236 predicted 461
4 SASI_Rn02_00247237 predicted 1134
5 SASI_Rn02_00247238 predicted 518
6 SASI_Rn02_00247239 predicted 505
7 SASI_Rn02_00247240 predicted 280
8 SASI_Rn02_00247241 predicted 453
9 SASI_Rn02_00247242 predicted 1182
10 SASI_Rn02_00247243 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339797 predicted 1099
2 SASI_Mm01_00144164 predicted 448
3 SASI_Mm02_00339798 predicted 1133
4 SASI_Mm01_00144165 predicted 438
5 SASI_Mm01_00144166 predicted 454
6 SASI_Mm02_00339799 predicted 1085
7 SASI_Mm02_00339800 predicted 1107
8 SASI_Mm01_00144167 predicted 510
9 SASI_Mm01_00144169 predicted 276
10 SASI_Mm02_00339801 predicted 1158
11 SASI_Mm01_00144168 predicted 315
12 SASI_Mm01_00144170 predicted 566
13 SASI_Mm01_00144171 predicted 494
14 SASI_Mm01_00144172 predicted 489
15 SASI_Mm01_00144173 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346667 predicted 1095
2 SASI_Mm01_00182440 predicted 449
3 SASI_Mm02_00346668 predicted 1123
4 SASI_Mm01_00182441 predicted 440
5 SASI_Mm01_00182442 predicted 447
6 SASI_Mm02_00346669 predicted 1088
7 SASI_Mm02_00346670 predicted 1111
8 SASI_Mm01_00182443 predicted 511
9 SASI_Mm01_00182445 predicted 271
10 SASI_Mm02_00346671 predicted 1149
11 SASI_Mm01_00182444 predicted 316
12 SASI_Mm01_00182446 predicted 553
13 SASI_Mm01_00182447 predicted 493
14 SASI_Mm01_00182448 predicted 492
15 SASI_Mm01_00182449 predicted 543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031442
VALIDATED
TMEM47 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 47
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031442.2-538s1c1
Sequence:CCGGCATTGCATTCCTGGTGGGTTTCTCGAGAAACCCACCAGGAATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031442.2-542s1c1
Sequence:CCGGGCATTCCTGGTGGGTTTGATTCTCGAGAATCAAACCCACCAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_031442.2-491s1c1
Sequence:CCGGCAGATTGCTACTCTGGCTTTACTCGAGTAAAGCCAGAGTAGCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031442.2-763s1c1
Sequence:CCGGCCTTTATTGCCTGAACCCTAACTCGAGTTAGGGTTCAGGCAATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031442.2-2132s1c1
Sequence:CCGGGCACACACTTAGGATGGATTTCTCGAGAAATCCATCCTAAGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031442.2-991s1c1
Sequence:CCGGGCACAAATTAAGAGAGCTGATCTCGAGATCAGCTCTCTTAATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031442.2-652s1c1
Sequence:CCGGCCTTTACCCAATCAAGTTCATCTCGAGATGAACTTGATTGGGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_031442.3-652s21c1
Sequence:CCGGCCTTTACCCAATCAAGTTCATCTCGAGATGAACTTGATTGGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_031442.3-543s21c1
Sequence:CCGGCATTCCTGGTGGGTTTGATTTCTCGAGAAATCAAACCCACCAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_031442.3-2132s21c1
Sequence:CCGGGCACACACTTAGGATGGATTTCTCGAGAAATCCATCCTAAGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_031442.3-491s21c1
Sequence:CCGGCAGATTGCTACTCTGGCTTTACTCGAGTAAAGCCAGAGTAGCAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031442
VALIDATED
TMEM47 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 47
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031442.2-538s1c1
Sequence:CCGGCATTGCATTCCTGGTGGGTTTCTCGAGAAACCCACCAGGAATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031442.2-542s1c1
Sequence:CCGGGCATTCCTGGTGGGTTTGATTCTCGAGAATCAAACCCACCAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_031442.2-491s1c1
Sequence:CCGGCAGATTGCTACTCTGGCTTTACTCGAGTAAAGCCAGAGTAGCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031442.2-763s1c1
Sequence:CCGGCCTTTATTGCCTGAACCCTAACTCGAGTTAGGGTTCAGGCAATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031442.2-2132s1c1
Sequence:CCGGGCACACACTTAGGATGGATTTCTCGAGAAATCCATCCTAAGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031442.2-991s1c1
Sequence:CCGGGCACAAATTAAGAGAGCTGATCTCGAGATCAGCTCTCTTAATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031442.2-652s1c1
Sequence:CCGGCCTTTACCCAATCAAGTTCATCTCGAGATGAACTTGATTGGGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_031442.3-652s21c1
Sequence:CCGGCCTTTACCCAATCAAGTTCATCTCGAGATGAACTTGATTGGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_031442.3-543s21c1
Sequence:CCGGCATTCCTGGTGGGTTTGATTTCTCGAGAAATCAAACCCACCAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_031442.3-2132s21c1
Sequence:CCGGGCACACACTTAGGATGGATTTCTCGAGAAATCCATCCTAAGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_031442.3-491s21c1
Sequence:CCGGCAGATTGCTACTCTGGCTTTACTCGAGTAAAGCCAGAGTAGCAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031442
VALIDATED
TMEM47 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 47
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031442.2-538s1c1
Sequence:CCGGCATTGCATTCCTGGTGGGTTTCTCGAGAAACCCACCAGGAATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031442.2-542s1c1
Sequence:CCGGGCATTCCTGGTGGGTTTGATTCTCGAGAATCAAACCCACCAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_031442.2-491s1c1
Sequence:CCGGCAGATTGCTACTCTGGCTTTACTCGAGTAAAGCCAGAGTAGCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031442.2-763s1c1
Sequence:CCGGCCTTTATTGCCTGAACCCTAACTCGAGTTAGGGTTCAGGCAATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031442.2-2132s1c1
Sequence:CCGGGCACACACTTAGGATGGATTTCTCGAGAAATCCATCCTAAGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031442.2-991s1c1
Sequence:CCGGGCACAAATTAAGAGAGCTGATCTCGAGATCAGCTCTCTTAATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031442.2-652s1c1
Sequence:CCGGCCTTTACCCAATCAAGTTCATCTCGAGATGAACTTGATTGGGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_031442.3-652s21c1
Sequence:CCGGCCTTTACCCAATCAAGTTCATCTCGAGATGAACTTGATTGGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_031442.3-543s21c1
Sequence:CCGGCATTCCTGGTGGGTTTGATTTCTCGAGAAATCAAACCCACCAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_031442.3-2132s21c1
Sequence:CCGGGCACACACTTAGGATGGATTTCTCGAGAAATCCATCCTAAGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_031442.3-491s21c1
Sequence:CCGGCAGATTGCTACTCTGGCTTTACTCGAGTAAAGCCAGAGTAGCAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175771
VALIDATED
TMEM47 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 47
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-1060s1c1
Sequence:CCGGGCTGATTAGATATAGGCATATCTCGAGATATGCCTATATCTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-604s1c1
Sequence:CCGGCAGCCTGGTTCTTTATCCAATCTCGAGATTGGATAAAGAACCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-503s1c1
Sequence:CCGGGCATTCCTGGTGGGTTTGATTCTCGAGAATCAAACCCACCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-718s1c1
Sequence:CCGGTGCCATTCTTTATTGCCTGAACTCGAGTTCAGGCAATAAAGAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-451s1c1
Sequence:CCGGGCAGATTGCTACTCTGGCTTTCTCGAGAAAGCCAGAGTAGCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175771.4-450s21c1
Sequence:CCGGGCAGATTGCTACTCTGGCTTTCTCGAGAAAGCCAGAGTAGCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175771.4-502s21c1
Sequence:CCGGGCATTCCTGGTGGGTTTGATTCTCGAGAATCAAACCCACCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175771.4-603s21c1
Sequence:CCGGCAGCCTGGTTCTTTATCCAATCTCGAGATTGGATAAAGAACCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175771.4-717s21c1
Sequence:CCGGTGCCATTCTTTATTGCCTGAACTCGAGTTCAGGCAATAAAGAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175771
VALIDATED
TMEM47 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 47
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-1060s1c1
Sequence:CCGGGCTGATTAGATATAGGCATATCTCGAGATATGCCTATATCTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-604s1c1
Sequence:CCGGCAGCCTGGTTCTTTATCCAATCTCGAGATTGGATAAAGAACCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-503s1c1
Sequence:CCGGGCATTCCTGGTGGGTTTGATTCTCGAGAATCAAACCCACCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-718s1c1
Sequence:CCGGTGCCATTCTTTATTGCCTGAACTCGAGTTCAGGCAATAAAGAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-451s1c1
Sequence:CCGGGCAGATTGCTACTCTGGCTTTCTCGAGAAAGCCAGAGTAGCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175771.4-450s21c1
Sequence:CCGGGCAGATTGCTACTCTGGCTTTCTCGAGAAAGCCAGAGTAGCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175771.4-502s21c1
Sequence:CCGGGCATTCCTGGTGGGTTTGATTCTCGAGAATCAAACCCACCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175771.4-603s21c1
Sequence:CCGGCAGCCTGGTTCTTTATCCAATCTCGAGATTGGATAAAGAACCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175771.4-717s21c1
Sequence:CCGGTGCCATTCTTTATTGCCTGAACTCGAGTTCAGGCAATAAAGAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175771
VALIDATED
TMEM47 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 47
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-1060s1c1
Sequence:CCGGGCTGATTAGATATAGGCATATCTCGAGATATGCCTATATCTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-604s1c1
Sequence:CCGGCAGCCTGGTTCTTTATCCAATCTCGAGATTGGATAAAGAACCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-503s1c1
Sequence:CCGGGCATTCCTGGTGGGTTTGATTCTCGAGAATCAAACCCACCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-718s1c1
Sequence:CCGGTGCCATTCTTTATTGCCTGAACTCGAGTTCAGGCAATAAAGAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175771.2-451s1c1
Sequence:CCGGGCAGATTGCTACTCTGGCTTTCTCGAGAAAGCCAGAGTAGCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175771.4-450s21c1
Sequence:CCGGGCAGATTGCTACTCTGGCTTTCTCGAGAAAGCCAGAGTAGCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175771.4-502s21c1
Sequence:CCGGGCATTCCTGGTGGGTTTGATTCTCGAGAATCAAACCCACCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175771.4-603s21c1
Sequence:CCGGCAGCCTGGTTCTTTATCCAATCTCGAGATTGGATAAAGAACCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175771.4-717s21c1
Sequence:CCGGTGCCATTCTTTATTGCCTGAACTCGAGTTCAGGCAATAAAGAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks