EMAIL THIS PAGE TO A FRIEND

TMEM50A

transmembrane protein 50A

Synonyms: IFNRC SMP1
UniProtKB ID: O95807
Gene ID:
Human(23585) Summary: This gene is located in the RH gene locus, between the RHD and RHCE genes. The function of its protein product is unknown; however, its sequence has potential transmembrane domains suggesting that it may be an integral membrane protein. Its position between the RH genes suggests that polymorphisms in this gene may be tightly linked to RH haplotypes and may contribute to selective pressure for or against certain RH haplotypes. [provided by RefSeq, Jul 2008]
Mouse(71817) transmembrane protein 50A
Rat(298552) transmembrane protein 50A
cow(504456) transmembrane protein 50A
sheep(101115098) transmembrane protein 50A
domestic guinea pig(100734446) transmembrane protein 50A
naked mole-rat(101696743) transmembrane protein 50A
Zebrafish(406850) transmembrane protein 50A
domestic cat(101080983) transmembrane protein 50A
dog(478181) transmembrane protein 50A
chicken(769637) transmembrane protein 50A
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA065192 Anti-TMEM50A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014313 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014313 Rosetta Predictions human pricing
NM_001127525 Rosetta Predictions rat pricing
NM_027935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073231 predicted 493
2 SASI_Hs01_00073233 predicted 909
3 SASI_Hs01_00073234 predicted 204
4 SASI_Hs01_00073235 predicted 452
5 SASI_Hs01_00073236 predicted 910
6 SASI_Hs01_00073237 predicted 613
7 SASI_Hs01_00073238 predicted 917
8 SASI_Hs01_00073239 predicted 474
9 SASI_Hs02_00345405 predicted 723
10 SASI_Hs02_00345406 predicted 608
11 SASI_Hs01_00073232 predicted 832
12 SASI_Hs01_00073240 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254003 predicted 441
2 SASI_Rn02_00254004 predicted 713
3 SASI_Rn02_00254005 predicted 311
4 SASI_Rn02_00254006 predicted 747
5 SASI_Rn02_00254007 predicted 451
6 SASI_Rn02_00254008 predicted 285
7 SASI_Rn02_00254009 predicted 696
8 SASI_Rn02_00254010 predicted 349
9 SASI_Rn02_00254011 predicted 572
10 SASI_Rn02_00254012 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332920 predicted 487
2 SASI_Mm02_00332921 predicted 413
3 SASI_Mm02_00332922 predicted 384
4 SASI_Mm02_00332923 predicted 222
5 SASI_Mm02_00332924 predicted 623
6 SASI_Mm02_00332925 predicted 244
7 SASI_Mm02_00332926 predicted 593
8 SASI_Mm02_00332927 predicted 602
9 SASI_Mm02_00332928 predicted 505
10 SASI_Mm02_00332929 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014313
VALIDATED
TMEM50A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 50A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014313.2-1761s1c1
Sequence:CCGGCCACATGAACTCCTGATGTTTCTCGAGAAACATCAGGAGTTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014313.2-472s1c1
Sequence:CCGGCTGATTGCATCTATGTGGATTCTCGAGAATCCACATAGATGCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014313.2-1968s1c1
Sequence:CCGGCCACAGTGCAATTCAGAATATCTCGAGATATTCTGAATTGCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014313.2-461s1c1
Sequence:CCGGCCTTTGGATCTCTGATTGCATCTCGAGATGCAATCAGAGATCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014313.2-346s1c1
Sequence:CCGGGCCTTCCTAATGATTAATGCACTCGAGTGCATTAATCATTAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014313.2-208s1c1
Sequence:CCGGCGCAATACTATTGCTTCCATTCTCGAGAATGGAAGCAATAGTATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014313.2-267s21c1
Sequence:CCGGCATAGATGCAGCTGTTATTTACTCGAGTAAATAACAGCTGCATCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014313.2-461s21c1
Sequence:CCGGCCTTTGGATCTCTGATTGCATCTCGAGATGCAATCAGAGATCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014313.2-375s21c1
Sequence:CCGGTGGACAAGTCCGAGGTGATAGCTCGAGCTATCACCTCGGACTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014313.2-346s21c1
Sequence:CCGGGCCTTCCTAATGATTAATGCACTCGAGTGCATTAATCATTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014313.2-1081s21c1
Sequence:CCGGCCTCACTATAATTGGTATTTACTCGAGTAAATACCAATTATAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014313
VALIDATED
TMEM50A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 50A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014313.2-1761s1c1
Sequence:CCGGCCACATGAACTCCTGATGTTTCTCGAGAAACATCAGGAGTTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014313.2-472s1c1
Sequence:CCGGCTGATTGCATCTATGTGGATTCTCGAGAATCCACATAGATGCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014313.2-1968s1c1
Sequence:CCGGCCACAGTGCAATTCAGAATATCTCGAGATATTCTGAATTGCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014313.2-461s1c1
Sequence:CCGGCCTTTGGATCTCTGATTGCATCTCGAGATGCAATCAGAGATCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014313.2-346s1c1
Sequence:CCGGGCCTTCCTAATGATTAATGCACTCGAGTGCATTAATCATTAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014313.2-208s1c1
Sequence:CCGGCGCAATACTATTGCTTCCATTCTCGAGAATGGAAGCAATAGTATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014313.2-267s21c1
Sequence:CCGGCATAGATGCAGCTGTTATTTACTCGAGTAAATAACAGCTGCATCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014313.2-461s21c1
Sequence:CCGGCCTTTGGATCTCTGATTGCATCTCGAGATGCAATCAGAGATCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014313.2-375s21c1
Sequence:CCGGTGGACAAGTCCGAGGTGATAGCTCGAGCTATCACCTCGGACTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014313.2-346s21c1
Sequence:CCGGGCCTTCCTAATGATTAATGCACTCGAGTGCATTAATCATTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014313.2-1081s21c1
Sequence:CCGGCCTCACTATAATTGGTATTTACTCGAGTAAATACCAATTATAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014313
VALIDATED
TMEM50A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 50A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014313.2-1761s1c1
Sequence:CCGGCCACATGAACTCCTGATGTTTCTCGAGAAACATCAGGAGTTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014313.2-472s1c1
Sequence:CCGGCTGATTGCATCTATGTGGATTCTCGAGAATCCACATAGATGCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014313.2-1968s1c1
Sequence:CCGGCCACAGTGCAATTCAGAATATCTCGAGATATTCTGAATTGCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014313.2-461s1c1
Sequence:CCGGCCTTTGGATCTCTGATTGCATCTCGAGATGCAATCAGAGATCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014313.2-346s1c1
Sequence:CCGGGCCTTCCTAATGATTAATGCACTCGAGTGCATTAATCATTAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014313.2-208s1c1
Sequence:CCGGCGCAATACTATTGCTTCCATTCTCGAGAATGGAAGCAATAGTATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014313.2-267s21c1
Sequence:CCGGCATAGATGCAGCTGTTATTTACTCGAGTAAATAACAGCTGCATCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014313.2-461s21c1
Sequence:CCGGCCTTTGGATCTCTGATTGCATCTCGAGATGCAATCAGAGATCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014313.2-375s21c1
Sequence:CCGGTGGACAAGTCCGAGGTGATAGCTCGAGCTATCACCTCGGACTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014313.2-346s21c1
Sequence:CCGGGCCTTCCTAATGATTAATGCACTCGAGTGCATTAATCATTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014313.2-1081s21c1
Sequence:CCGGCCTCACTATAATTGGTATTTACTCGAGTAAATACCAATTATAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027935
VALIDATED
TMEM50A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 50A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027935.1-261s1c1
Sequence:CCGGCAATTCAACCATTCATACCATCTCGAGATGGTATGAATGGTTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027935.1-455s1c1
Sequence:CCGGCTTTGGAGGTTATGTCGCTAACTCGAGTTAGCGACATAACCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027935.1-404s1c1
Sequence:CCGGCATCGGCTTCATGTTGGCTTTCTCGAGAAAGCCAACATGAAGCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027935.1-820s1c1
Sequence:CCGGCAGCTTCTATCATGGTCTAAACTCGAGTTTAGACCATGATAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027935.1-314s1c1
Sequence:CCGGCATGATTAACGCAGTATCGAACTCGAGTTCGATACTGCGTTAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027935.1-460s1c1
Sequence:CCGGGAGGTTATGTCGCTAAGGAAACTCGAGTTTCCTTAGCGACATAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216238    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027935.2-623s1c1
Sequence:CCGGCTCAGCTTGAAATTGTATAATCTCGAGATTATACAATTTCAAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027935
VALIDATED
TMEM50A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 50A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027935.1-261s1c1
Sequence:CCGGCAATTCAACCATTCATACCATCTCGAGATGGTATGAATGGTTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027935.1-455s1c1
Sequence:CCGGCTTTGGAGGTTATGTCGCTAACTCGAGTTAGCGACATAACCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027935.1-404s1c1
Sequence:CCGGCATCGGCTTCATGTTGGCTTTCTCGAGAAAGCCAACATGAAGCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027935.1-820s1c1
Sequence:CCGGCAGCTTCTATCATGGTCTAAACTCGAGTTTAGACCATGATAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027935.1-314s1c1
Sequence:CCGGCATGATTAACGCAGTATCGAACTCGAGTTCGATACTGCGTTAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027935.1-460s1c1
Sequence:CCGGGAGGTTATGTCGCTAAGGAAACTCGAGTTTCCTTAGCGACATAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216238    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027935.2-623s1c1
Sequence:CCGGCTCAGCTTGAAATTGTATAATCTCGAGATTATACAATTTCAAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027935
VALIDATED
TMEM50A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 50A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027935.1-261s1c1
Sequence:CCGGCAATTCAACCATTCATACCATCTCGAGATGGTATGAATGGTTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027935.1-455s1c1
Sequence:CCGGCTTTGGAGGTTATGTCGCTAACTCGAGTTAGCGACATAACCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027935.1-404s1c1
Sequence:CCGGCATCGGCTTCATGTTGGCTTTCTCGAGAAAGCCAACATGAAGCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027935.1-820s1c1
Sequence:CCGGCAGCTTCTATCATGGTCTAAACTCGAGTTTAGACCATGATAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027935.1-314s1c1
Sequence:CCGGCATGATTAACGCAGTATCGAACTCGAGTTCGATACTGCGTTAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027935.1-460s1c1
Sequence:CCGGGAGGTTATGTCGCTAAGGAAACTCGAGTTTCCTTAGCGACATAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216238    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027935.2-623s1c1
Sequence:CCGGCTCAGCTTGAAATTGTATAATCTCGAGATTATACAATTTCAAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks