EMAIL THIS PAGE TO A FRIEND

TMEM50B

transmembrane protein 50B

Synonyms: C21orf4 HCVP7TP3
UniProtKB ID: P56557, B2R4L4, D3DSF1, O60537, Q5PY47
Gene ID:
Mouse(77975) transmembrane protein 50B
Rat(360698) transmembrane protein 50B
chicken(418503) transmembrane protein 50B
dog(478405) transmembrane protein 50B
domestic cat(101089791) transmembrane protein 50B
naked mole-rat(101725621) transmembrane protein 50B
Domestic Rabbit(100328810) transmembrane protein 50B
domestic guinea pig(100723806) transmembrane protein 50B
cow(615627) transmembrane protein 50B
sheep(101122237) transmembrane protein 50B
185 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030018 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030018 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030018 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006134 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006134 Rosetta Predictions human pricing
NM_001025014 Rosetta Predictions rat pricing
NM_030018 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042682 predicted 723
2 SASI_Hs01_00042683 predicted 605
3 SASI_Hs01_00042685 predicted 301
4 SASI_Hs01_00042686 predicted 307
5 SASI_Hs01_00042687 predicted 530
6 SASI_Hs01_00042688 predicted 238
7 SASI_Hs01_00042689 predicted 730
8 SASI_Hs02_00340963 predicted 489
9 SASI_Hs01_00042690 predicted 428
10 SASI_Hs01_00042691 predicted 632
11 SASI_Hs01_00042684 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076662 predicted 461
2 SASI_Rn01_00076663 predicted 811
3 SASI_Rn01_00076664 predicted 621
4 SASI_Rn01_00076665 predicted 406
5 SASI_Rn01_00076667 predicted 508
6 SASI_Rn01_00076668 predicted 734
7 SASI_Rn02_00202921 predicted 298
8 SASI_Rn01_00076669 predicted 697
9 SASI_Rn01_00076670 predicted 250
10 SASI_Rn01_00076671 predicted 472
11 SASI_Rn01_00076666 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030018 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070593 predicted 669
2 SASI_Mm01_00070594 predicted 389
3 SASI_Mm01_00070595 predicted 772
4 SASI_Mm01_00070596 predicted 702
5 SASI_Mm01_00070597 predicted 487
6 SASI_Mm01_00070598 predicted 526
7 SASI_Mm01_00070599 predicted 656
8 SASI_Mm02_00336388 predicted 451
9 SASI_Mm01_00070600 predicted 789
10 SASI_Mm01_00070601 predicted 736
11 SASI_Mm01_00070602 predicted 212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030018
TMEM50B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 50B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030018.3-742s21c1
Sequence:CCGGGCCCTGAGTTTGTCTTGGTTTCTCGAGAAACCAAGACAAACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030018.3-570s21c1
Sequence:CCGGAGCACTCTGATCTACAAATTTCTCGAGAAATTTGTAGATCAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030018.3-338s21c1
Sequence:CCGGGCTGGCCTTCTTCATGATAAACTCGAGTTTATCATGAAGAAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030018.3-423s21c1
Sequence:CCGGGCTCGGGTCTGGCTCTTCATTCTCGAGAATGAAGAGCCAGACCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030018.2-342s1c1
Sequence:CCGGCTGGCCTTCTTCATGATAAATCTCGAGATTTATCATGAAGAAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030018.2-341s1c1
Sequence:CCGGGCTGGCCTTCTTCATGATAAACTCGAGTTTATCATGAAGAAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030018.2-745s1c1
Sequence:CCGGGCCCTGAGTTTGTCTTGGTTTCTCGAGAAACCAAGACAAACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030018.2-426s1c1
Sequence:CCGGGCTCGGGTCTGGCTCTTCATTCTCGAGAATGAAGAGCCAGACCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030018.2-573s1c1
Sequence:CCGGAGCACTCTGATCTACAAATTTCTCGAGAAATTTGTAGATCAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030018
TMEM50B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 50B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030018.3-742s21c1
Sequence:CCGGGCCCTGAGTTTGTCTTGGTTTCTCGAGAAACCAAGACAAACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030018.3-570s21c1
Sequence:CCGGAGCACTCTGATCTACAAATTTCTCGAGAAATTTGTAGATCAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030018.3-338s21c1
Sequence:CCGGGCTGGCCTTCTTCATGATAAACTCGAGTTTATCATGAAGAAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030018.3-423s21c1
Sequence:CCGGGCTCGGGTCTGGCTCTTCATTCTCGAGAATGAAGAGCCAGACCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030018.2-342s1c1
Sequence:CCGGCTGGCCTTCTTCATGATAAATCTCGAGATTTATCATGAAGAAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030018.2-341s1c1
Sequence:CCGGGCTGGCCTTCTTCATGATAAACTCGAGTTTATCATGAAGAAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030018.2-745s1c1
Sequence:CCGGGCCCTGAGTTTGTCTTGGTTTCTCGAGAAACCAAGACAAACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030018.2-426s1c1
Sequence:CCGGGCTCGGGTCTGGCTCTTCATTCTCGAGAATGAAGAGCCAGACCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030018.2-573s1c1
Sequence:CCGGAGCACTCTGATCTACAAATTTCTCGAGAAATTTGTAGATCAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030018
TMEM50B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 50B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030018.3-742s21c1
Sequence:CCGGGCCCTGAGTTTGTCTTGGTTTCTCGAGAAACCAAGACAAACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030018.3-570s21c1
Sequence:CCGGAGCACTCTGATCTACAAATTTCTCGAGAAATTTGTAGATCAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030018.3-338s21c1
Sequence:CCGGGCTGGCCTTCTTCATGATAAACTCGAGTTTATCATGAAGAAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030018.3-423s21c1
Sequence:CCGGGCTCGGGTCTGGCTCTTCATTCTCGAGAATGAAGAGCCAGACCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030018.2-342s1c1
Sequence:CCGGCTGGCCTTCTTCATGATAAATCTCGAGATTTATCATGAAGAAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030018.2-341s1c1
Sequence:CCGGGCTGGCCTTCTTCATGATAAACTCGAGTTTATCATGAAGAAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030018.2-745s1c1
Sequence:CCGGGCCCTGAGTTTGTCTTGGTTTCTCGAGAAACCAAGACAAACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030018.2-426s1c1
Sequence:CCGGGCTCGGGTCTGGCTCTTCATTCTCGAGAATGAAGAGCCAGACCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030018.2-573s1c1
Sequence:CCGGAGCACTCTGATCTACAAATTTCTCGAGAAATTTGTAGATCAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006134
VALIDATED
TMEM50B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 50B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006134.5-506s21c1
Sequence:CCGGCTTATTGCTTCCATGTGGATTCTCGAGAATCCACATGGAAGCAATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006134.5-630s21c1
Sequence:CCGGGAAGAACCGAAGAGCTATGGACTCGAGTCCATAGCTCTTCGGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006134.5-319s21c1
Sequence:CCGGGTATCCTAAGCCAGAACAGTTCTCGAGAACTGTTCTGGCTTAGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006134.5-254s21c1
Sequence:CCGGGCATCTGTTGTCGCAGGTATACTCGAGTATACCTGCGACAACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006134.4-223s1c1
Sequence:CCGGGCATCTGTTGTCGCAGGTATACTCGAGTATACCTGCGACAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006134.4-191s1c1
Sequence:CCGGGTATTGACTGGAGTGAGAGAACTCGAGTTCTCTCACTCCAGTCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006134.4-288s1c1
Sequence:CCGGGTATCCTAAGCCAGAACAGTTCTCGAGAACTGTTCTGGCTTAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006134.4-599s1c1
Sequence:CCGGGAAGAACCGAAGAGCTATGGACTCGAGTCCATAGCTCTTCGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006134.4-475s1c1
Sequence:CCGGCTTATTGCTTCCATGTGGATTCTCGAGAATCCACATGGAAGCAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006134.4-459s1c1
Sequence:CCGGGTTGATGTTTGGGTCACTTATCTCGAGATAAGTGACCCAAACATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006134.4-2877s1c1
Sequence:CCGGCGCACAACACAAACATCAGTTCTCGAGAACTGATGTTTGTGTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006134
VALIDATED
TMEM50B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 50B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006134.5-506s21c1
Sequence:CCGGCTTATTGCTTCCATGTGGATTCTCGAGAATCCACATGGAAGCAATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006134.5-630s21c1
Sequence:CCGGGAAGAACCGAAGAGCTATGGACTCGAGTCCATAGCTCTTCGGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006134.5-319s21c1
Sequence:CCGGGTATCCTAAGCCAGAACAGTTCTCGAGAACTGTTCTGGCTTAGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006134.5-254s21c1
Sequence:CCGGGCATCTGTTGTCGCAGGTATACTCGAGTATACCTGCGACAACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006134.4-223s1c1
Sequence:CCGGGCATCTGTTGTCGCAGGTATACTCGAGTATACCTGCGACAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006134.4-191s1c1
Sequence:CCGGGTATTGACTGGAGTGAGAGAACTCGAGTTCTCTCACTCCAGTCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006134.4-288s1c1
Sequence:CCGGGTATCCTAAGCCAGAACAGTTCTCGAGAACTGTTCTGGCTTAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006134.4-599s1c1
Sequence:CCGGGAAGAACCGAAGAGCTATGGACTCGAGTCCATAGCTCTTCGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006134.4-475s1c1
Sequence:CCGGCTTATTGCTTCCATGTGGATTCTCGAGAATCCACATGGAAGCAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006134.4-459s1c1
Sequence:CCGGGTTGATGTTTGGGTCACTTATCTCGAGATAAGTGACCCAAACATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006134.4-2877s1c1
Sequence:CCGGCGCACAACACAAACATCAGTTCTCGAGAACTGATGTTTGTGTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006134
VALIDATED
TMEM50B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 50B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006134.5-506s21c1
Sequence:CCGGCTTATTGCTTCCATGTGGATTCTCGAGAATCCACATGGAAGCAATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006134.5-630s21c1
Sequence:CCGGGAAGAACCGAAGAGCTATGGACTCGAGTCCATAGCTCTTCGGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006134.5-319s21c1
Sequence:CCGGGTATCCTAAGCCAGAACAGTTCTCGAGAACTGTTCTGGCTTAGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006134.5-254s21c1
Sequence:CCGGGCATCTGTTGTCGCAGGTATACTCGAGTATACCTGCGACAACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006134.4-223s1c1
Sequence:CCGGGCATCTGTTGTCGCAGGTATACTCGAGTATACCTGCGACAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006134.4-191s1c1
Sequence:CCGGGTATTGACTGGAGTGAGAGAACTCGAGTTCTCTCACTCCAGTCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006134.4-288s1c1
Sequence:CCGGGTATCCTAAGCCAGAACAGTTCTCGAGAACTGTTCTGGCTTAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006134.4-599s1c1
Sequence:CCGGGAAGAACCGAAGAGCTATGGACTCGAGTCCATAGCTCTTCGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006134.4-475s1c1
Sequence:CCGGCTTATTGCTTCCATGTGGATTCTCGAGAATCCACATGGAAGCAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006134.4-459s1c1
Sequence:CCGGGTTGATGTTTGGGTCACTTATCTCGAGATAAGTGACCCAAACATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006134.4-2877s1c1
Sequence:CCGGCGCACAACACAAACATCAGTTCTCGAGAACTGATGTTTGTGTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks