EMAIL THIS PAGE TO A FRIEND

TMEM51-AS1

TMEM51 antisense RNA 1

Synonyms: C1orf126 RP1-21O18.2
Species: Human TMEM51-AS1(200197)
Gene ID:
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182534 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182534 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215177 predicted 391
2 SASI_Hs01_00215178 predicted 128
3 SASI_Hs01_00215179 predicted 121
4 SASI_Hs01_00215180 predicted 153
5 SASI_Hs01_00215181 predicted 288
6 SASI_Hs01_00215182 predicted 372
7 SASI_Hs01_00215183 predicted 904
8 SASI_Hs01_00215184 predicted 675
9 SASI_Hs01_00215185 predicted 138
10 SASI_Hs01_00215186 predicted 409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182534
TMEM51-AS1 MISSION shRNA Bacterial Glycerol Stock
TMEM51 antisense RNA 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182534.1-2368s1c1
Sequence:CCGGGCCGAATGTCATGAAGATAATCTCGAGATTATCTTCATGACATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182534.1-115s1c1
Sequence:CCGGGCCATTCTGGCTTCTTAACTTCTCGAGAAGTTAAGAAGCCAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182534.1-82s1c1
Sequence:CCGGGTTGTAACATGCGGGCATTTCCTCGAGGAAATGCCCGCATGTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182534.1-2730s1c1
Sequence:CCGGCGAGCATCATGGTTCCAACAACTCGAGTTGTTGGAACCATGATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182534.1-376s1c1
Sequence:CCGGCCTACAGACCTCCCACAAATTCTCGAGAATTTGTGGGAGGTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139669    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182534.1-2081s1c1
Sequence:CCGGCCAGCAAGATCGAACCATGTACTCGAGTACATGGTTCGATCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182534.1-387s1c1
Sequence:CCGGCCCACAAATTACCGTAATGCACTCGAGTGCATTACGGTAATTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182534.1-80s1c1
Sequence:CCGGGAGTTGTAACATGCGGGCATTCTCGAGAATGCCCGCATGTTACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182534.1-2091s1c1
Sequence:CCGGCGAACCATGTAAGTGCCATTTCTCGAGAAATGGCACTTACATGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182534.1-2758s1c1
Sequence:CCGGGCTTTGATAACCCGATGTGTACTCGAGTACACATCGGGTTATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182534
TMEM51-AS1 MISSION shRNA shRNA Plasmid DNA
TMEM51 antisense RNA 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182534.1-2368s1c1
Sequence:CCGGGCCGAATGTCATGAAGATAATCTCGAGATTATCTTCATGACATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182534.1-115s1c1
Sequence:CCGGGCCATTCTGGCTTCTTAACTTCTCGAGAAGTTAAGAAGCCAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182534.1-82s1c1
Sequence:CCGGGTTGTAACATGCGGGCATTTCCTCGAGGAAATGCCCGCATGTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182534.1-2730s1c1
Sequence:CCGGCGAGCATCATGGTTCCAACAACTCGAGTTGTTGGAACCATGATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182534.1-376s1c1
Sequence:CCGGCCTACAGACCTCCCACAAATTCTCGAGAATTTGTGGGAGGTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139669    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182534.1-2081s1c1
Sequence:CCGGCCAGCAAGATCGAACCATGTACTCGAGTACATGGTTCGATCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182534.1-387s1c1
Sequence:CCGGCCCACAAATTACCGTAATGCACTCGAGTGCATTACGGTAATTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182534.1-80s1c1
Sequence:CCGGGAGTTGTAACATGCGGGCATTCTCGAGAATGCCCGCATGTTACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182534.1-2091s1c1
Sequence:CCGGCGAACCATGTAAGTGCCATTTCTCGAGAAATGGCACTTACATGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182534.1-2758s1c1
Sequence:CCGGGCTTTGATAACCCGATGTGTACTCGAGTACACATCGGGTTATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182534
TMEM51-AS1 MISSION shRNA Lentiviral Transduction Particles
TMEM51 antisense RNA 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182534.1-2368s1c1
Sequence:CCGGGCCGAATGTCATGAAGATAATCTCGAGATTATCTTCATGACATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182534.1-115s1c1
Sequence:CCGGGCCATTCTGGCTTCTTAACTTCTCGAGAAGTTAAGAAGCCAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182534.1-82s1c1
Sequence:CCGGGTTGTAACATGCGGGCATTTCCTCGAGGAAATGCCCGCATGTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182534.1-2730s1c1
Sequence:CCGGCGAGCATCATGGTTCCAACAACTCGAGTTGTTGGAACCATGATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182534.1-376s1c1
Sequence:CCGGCCTACAGACCTCCCACAAATTCTCGAGAATTTGTGGGAGGTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139669    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182534.1-2081s1c1
Sequence:CCGGCCAGCAAGATCGAACCATGTACTCGAGTACATGGTTCGATCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182534.1-387s1c1
Sequence:CCGGCCCACAAATTACCGTAATGCACTCGAGTGCATTACGGTAATTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182534.1-80s1c1
Sequence:CCGGGAGTTGTAACATGCGGGCATTCTCGAGAATGCCCGCATGTTACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182534.1-2091s1c1
Sequence:CCGGCGAACCATGTAAGTGCCATTTCTCGAGAAATGGCACTTACATGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182534.1-2758s1c1
Sequence:CCGGGCTTTGATAACCCGATGTGTACTCGAGTACACATCGGGTTATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks