EMAIL THIS PAGE TO A FRIEND

TMEM51

transmembrane protein 51

Synonyms: C1orf72
UniProtKB ID: Q9NW97, A8K819
Gene ID:
Mouse(214359) transmembrane protein 51
Rat(500578) transmembrane protein 51
cow(514936) transmembrane protein 51
sheep(101111728) transmembrane protein 51
domestic guinea pig(100733608) transmembrane protein 51
naked mole-rat(101702546) transmembrane protein 51
chicken(771913) transmembrane protein 51
domestic cat(101080982) transmembrane protein 51
dog(607267) transmembrane protein 51
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018022 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018022 Rosetta Predictions human pricing
NM_001109273 Rosetta Predictions rat pricing
NM_145402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038733 predicted 488
2 SASI_Hs01_00038734 predicted 1454
3 SASI_Hs01_00038735 predicted 1490
4 SASI_Hs01_00038736 predicted 1049
5 SASI_Hs01_00038737 predicted 1457
6 SASI_Hs01_00038738 predicted 518
7 SASI_Hs01_00038739 predicted 1394
8 SASI_Hs01_00038740 predicted 1118
9 SASI_Hs02_00351122 predicted 1408
10 SASI_Hs01_00038742 predicted 1226
11 SASI_Hs01_00038741 predicted 1478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246794 predicted 1626
2 SASI_Rn02_00246795 predicted 1641
3 SASI_Rn02_00246796 predicted 1643
4 SASI_Rn02_00246797 predicted 1324
5 SASI_Rn02_00246798 predicted 690
6 SASI_Rn02_00246799 predicted 953
7 SASI_Rn02_00246800 predicted 1458
8 SASI_Rn02_00246801 predicted 1376
9 SASI_Rn02_00246802 predicted 661
10 SASI_Rn02_00246803 predicted 1674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089336 predicted 706
2 SASI_Mm01_00089337 predicted 1460
3 SASI_Mm01_00089338 predicted 1017
4 SASI_Mm01_00089339 predicted 813
5 SASI_Mm01_00089340 predicted 1165
6 SASI_Mm01_00089341 predicted 801
7 SASI_Mm01_00089342 predicted 1514
8 SASI_Mm01_00089343 predicted 1352
9 SASI_Mm01_00089344 predicted 781
10 SASI_Mm02_00340735 predicted 963
11 SASI_Mm01_00089345 predicted 1448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018022
VALIDATED
TMEM51 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 51
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018022.1-1512s1c1
Sequence:CCGGCTGGTTTAGATTGTGGTTGTTCTCGAGAACAACCACAATCTAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018022.1-1015s1c1
Sequence:CCGGGCTGAAAGTTCGAAGGATTAACTCGAGTTAATCCTTCGAACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018022.1-1321s1c1
Sequence:CCGGCTCTGTATCAGGAGTGACTTTCTCGAGAAAGTCACTCCTGATACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018022.1-1051s1c1
Sequence:CCGGCCTCAAAGACTTTAGGATCAACTCGAGTTGATCCTAAAGTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018022.1-1511s1c1
Sequence:CCGGGCTGGTTTAGATTGTGGTTGTCTCGAGACAACCACAATCTAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018022.1-649s1c1
Sequence:CCGGGCTTTCTATCTGCCTGAGTATCTCGAGATACTCAGGCAGATAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018022.2-1015s21c1
Sequence:CCGGGCTGAAAGTTCGAAGGATTAACTCGAGTTAATCCTTCGAACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018022.2-1051s21c1
Sequence:CCGGCCTCAAAGACTTTAGGATCAACTCGAGTTGATCCTAAAGTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018022.2-786s21c1
Sequence:CCGGAGGCTGCCTCAAGGTACTATGCTCGAGCATAGTACCTTGAGGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018022.2-993s21c1
Sequence:CCGGAGTTGGCCAAACGACTGAAACCTCGAGGTTTCAGTCGTTTGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018022.2-1402s21c1
Sequence:CCGGGTGAATCTGTGGACCACATTCCTCGAGGAATGTGGTCCACAGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018022
VALIDATED
TMEM51 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 51
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018022.1-1512s1c1
Sequence:CCGGCTGGTTTAGATTGTGGTTGTTCTCGAGAACAACCACAATCTAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018022.1-1015s1c1
Sequence:CCGGGCTGAAAGTTCGAAGGATTAACTCGAGTTAATCCTTCGAACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018022.1-1321s1c1
Sequence:CCGGCTCTGTATCAGGAGTGACTTTCTCGAGAAAGTCACTCCTGATACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018022.1-1051s1c1
Sequence:CCGGCCTCAAAGACTTTAGGATCAACTCGAGTTGATCCTAAAGTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018022.1-1511s1c1
Sequence:CCGGGCTGGTTTAGATTGTGGTTGTCTCGAGACAACCACAATCTAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018022.1-649s1c1
Sequence:CCGGGCTTTCTATCTGCCTGAGTATCTCGAGATACTCAGGCAGATAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018022.2-1015s21c1
Sequence:CCGGGCTGAAAGTTCGAAGGATTAACTCGAGTTAATCCTTCGAACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018022.2-1051s21c1
Sequence:CCGGCCTCAAAGACTTTAGGATCAACTCGAGTTGATCCTAAAGTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018022.2-786s21c1
Sequence:CCGGAGGCTGCCTCAAGGTACTATGCTCGAGCATAGTACCTTGAGGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018022.2-993s21c1
Sequence:CCGGAGTTGGCCAAACGACTGAAACCTCGAGGTTTCAGTCGTTTGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018022.2-1402s21c1
Sequence:CCGGGTGAATCTGTGGACCACATTCCTCGAGGAATGTGGTCCACAGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018022
VALIDATED
TMEM51 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 51
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018022.1-1512s1c1
Sequence:CCGGCTGGTTTAGATTGTGGTTGTTCTCGAGAACAACCACAATCTAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018022.1-1015s1c1
Sequence:CCGGGCTGAAAGTTCGAAGGATTAACTCGAGTTAATCCTTCGAACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018022.1-1321s1c1
Sequence:CCGGCTCTGTATCAGGAGTGACTTTCTCGAGAAAGTCACTCCTGATACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018022.1-1051s1c1
Sequence:CCGGCCTCAAAGACTTTAGGATCAACTCGAGTTGATCCTAAAGTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018022.1-1511s1c1
Sequence:CCGGGCTGGTTTAGATTGTGGTTGTCTCGAGACAACCACAATCTAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018022.1-649s1c1
Sequence:CCGGGCTTTCTATCTGCCTGAGTATCTCGAGATACTCAGGCAGATAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018022.2-1015s21c1
Sequence:CCGGGCTGAAAGTTCGAAGGATTAACTCGAGTTAATCCTTCGAACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018022.2-1051s21c1
Sequence:CCGGCCTCAAAGACTTTAGGATCAACTCGAGTTGATCCTAAAGTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018022.2-786s21c1
Sequence:CCGGAGGCTGCCTCAAGGTACTATGCTCGAGCATAGTACCTTGAGGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018022.2-993s21c1
Sequence:CCGGAGTTGGCCAAACGACTGAAACCTCGAGGTTTCAGTCGTTTGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018022.2-1402s21c1
Sequence:CCGGGTGAATCTGTGGACCACATTCCTCGAGGAATGTGGTCCACAGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145402
VALIDATED
TMEM51 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 51
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145402.2-815s1c1
Sequence:CCGGGAGCTACGAGGAAGTGATGAACTCGAGTTCATCACTTCCTCGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145402.2-1017s1c1
Sequence:CCGGCCACTCAAAGTTCGAAGGATTCTCGAGAATCCTTCGAACTTTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145402.3-1469s21c1
Sequence:CCGGCGATCCCTAGTGACTCGTTTACTCGAGTAAACGAGTCACTAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145402.3-869s21c1
Sequence:CCGGGAACCCAAGACTGAGCATTTCCTCGAGGAAATGCTCAGTCTTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145402.3-559s21c1
Sequence:CCGGCAACGTCTCAGGGCAACAAGACTCGAGTCTTGTTGCCCTGAGACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217841    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145402.3-1697s1c1
Sequence:CCGGCTGGTTCTTTGAAGGTCTAAGCTCGAGCTTAGACCTTCAAAGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145402.3-1020s21c1
Sequence:CCGGCTCAAAGTTCGAAGGATTAAACTCGAGTTTAATCCTTCGAACTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145402.3-536s21c1
Sequence:CCGGTGGTTTCAGCCCTGCGGATAACTCGAGTTATCCGCAGGGCTGAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145402
VALIDATED
TMEM51 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 51
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145402.2-815s1c1
Sequence:CCGGGAGCTACGAGGAAGTGATGAACTCGAGTTCATCACTTCCTCGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145402.2-1017s1c1
Sequence:CCGGCCACTCAAAGTTCGAAGGATTCTCGAGAATCCTTCGAACTTTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145402.3-1469s21c1
Sequence:CCGGCGATCCCTAGTGACTCGTTTACTCGAGTAAACGAGTCACTAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145402.3-869s21c1
Sequence:CCGGGAACCCAAGACTGAGCATTTCCTCGAGGAAATGCTCAGTCTTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145402.3-559s21c1
Sequence:CCGGCAACGTCTCAGGGCAACAAGACTCGAGTCTTGTTGCCCTGAGACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217841    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145402.3-1697s1c1
Sequence:CCGGCTGGTTCTTTGAAGGTCTAAGCTCGAGCTTAGACCTTCAAAGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145402.3-1020s21c1
Sequence:CCGGCTCAAAGTTCGAAGGATTAAACTCGAGTTTAATCCTTCGAACTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145402.3-536s21c1
Sequence:CCGGTGGTTTCAGCCCTGCGGATAACTCGAGTTATCCGCAGGGCTGAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145402
VALIDATED
TMEM51 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 51
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145402.2-815s1c1
Sequence:CCGGGAGCTACGAGGAAGTGATGAACTCGAGTTCATCACTTCCTCGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145402.2-1017s1c1
Sequence:CCGGCCACTCAAAGTTCGAAGGATTCTCGAGAATCCTTCGAACTTTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145402.3-1469s21c1
Sequence:CCGGCGATCCCTAGTGACTCGTTTACTCGAGTAAACGAGTCACTAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145402.3-869s21c1
Sequence:CCGGGAACCCAAGACTGAGCATTTCCTCGAGGAAATGCTCAGTCTTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145402.3-559s21c1
Sequence:CCGGCAACGTCTCAGGGCAACAAGACTCGAGTCTTGTTGCCCTGAGACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217841    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145402.3-1697s1c1
Sequence:CCGGCTGGTTCTTTGAAGGTCTAAGCTCGAGCTTAGACCTTCAAAGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145402.3-1020s21c1
Sequence:CCGGCTCAAAGTTCGAAGGATTAAACTCGAGTTTAATCCTTCGAACTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145402.3-536s21c1
Sequence:CCGGTGGTTTCAGCCCTGCGGATAACTCGAGTTATCCGCAGGGCTGAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks