EMAIL THIS PAGE TO A FRIEND

TMEM52

transmembrane protein 52

UniProtKB ID: Q8NDY8, Q4VXS6, Q6UX25
Gene ID:
Mouse(69671) transmembrane protein 52
Rat(100362283) transmembrane protein 52
cow(617403) transmembrane protein 52
sheep(101123315) transmembrane protein 52
naked mole-rat(101702727) transmembrane protein 52
chicken(419401) transmembrane protein 52
dog(607284) transmembrane protein 52
domestic cat(101087077) transmembrane protein 52
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178545 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178545 Rosetta Predictions human pricing
XM_131826 Rosetta Predictions mouse pricing
XM_910794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128776 predicted 348
2 SASI_Hs01_00128777 predicted 529
3 SASI_Hs01_00128779 predicted 514
4 SASI_Hs01_00128780 predicted 511
5 SASI_Hs01_00128781 predicted 707
6 SASI_Hs01_00128783 predicted 689
7 SASI_Hs01_00128784 predicted 349
8 SASI_Hs01_00128785 predicted 512
9 SASI_Hs02_00369780 predicted 512
10 SASI_Hs01_00128778 predicted 697
11 SASI_Hs01_00128782 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424442 predicted 495
2 SASI_Mm02_00424443 predicted 537
3 SASI_Mm02_00424444 predicted 494
4 SASI_Mm02_00424445 predicted 498
5 SASI_Mm02_00424446 predicted 577
6 SASI_Mm02_00424447 predicted 531
7 SASI_Mm02_00424448 predicted 531
8 SASI_Mm02_00424449 predicted 500
9 SASI_Mm02_00424450 predicted 519
10 SASI_Mm02_00424451 predicted 169
11 SASI_Mm01_00284369 predicted 447
12 SASI_Mm01_00284370 predicted 207
13 SASI_Mm01_00284371 predicted 401
14 SASI_Mm01_00284372 predicted 343
15 SASI_Mm01_00284373 predicted 218
16 SASI_Mm01_00284374 predicted 277
17 SASI_Mm01_00284375 predicted 286
18 SASI_Mm01_00284376 predicted 401
19 SASI_Mm01_00284377 predicted 338
20 SASI_Mm01_00284378 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435923 predicted 591
2 SASI_Mm02_00435924 predicted 291
3 SASI_Mm02_00435925 predicted 653
4 SASI_Mm02_00435926 predicted 595
5 SASI_Mm02_00435927 predicted 341
6 SASI_Mm02_00435928 predicted 339
7 SASI_Mm02_00435929 predicted 212
8 SASI_Mm02_00435930 predicted 453
9 SASI_Mm02_00435931 predicted 425
10 SASI_Mm02_00435932 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178545
TMEM52 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 52
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178545.2-517s1c1
Sequence:CCGGCCTACGATGAAGCTGTCAAGACTCGAGTCTTGACAGCTTCATCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178545.2-641s1c1
Sequence:CCGGCAATACTCAACTACCACCTTGCTCGAGCAAGGTGGTAGTTGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178545.2-639s1c1
Sequence:CCGGCCCAATACTCAACTACCACCTCTCGAGAGGTGGTAGTTGAGTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178545.3-629s21c1
Sequence:CCGGATACTCAACTACCACCTTGTACTCGAGTACAAGGTGGTAGTTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178545.3-684s21c1
Sequence:CCGGACCAGAGCTTGGAGAACTAATCTCGAGATTAGTTCTCCAAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178545.3-371s21c1
Sequence:CCGGACAGCACTGTGACCTCCTACACTCGAGTGTAGGAGGTCACAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178545.3-660s21c1
Sequence:CCGGCCCTTGAAGGAGGTAGGAGAACTCGAGTTCTCCTACCTCCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178545.3-504s21c1
Sequence:CCGGCTACGATGAAGCTGTCAAGATCTCGAGATCTTGACAGCTTCATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178545
TMEM52 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 52
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178545.2-517s1c1
Sequence:CCGGCCTACGATGAAGCTGTCAAGACTCGAGTCTTGACAGCTTCATCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178545.2-641s1c1
Sequence:CCGGCAATACTCAACTACCACCTTGCTCGAGCAAGGTGGTAGTTGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178545.2-639s1c1
Sequence:CCGGCCCAATACTCAACTACCACCTCTCGAGAGGTGGTAGTTGAGTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178545.3-629s21c1
Sequence:CCGGATACTCAACTACCACCTTGTACTCGAGTACAAGGTGGTAGTTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178545.3-684s21c1
Sequence:CCGGACCAGAGCTTGGAGAACTAATCTCGAGATTAGTTCTCCAAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178545.3-371s21c1
Sequence:CCGGACAGCACTGTGACCTCCTACACTCGAGTGTAGGAGGTCACAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178545.3-660s21c1
Sequence:CCGGCCCTTGAAGGAGGTAGGAGAACTCGAGTTCTCCTACCTCCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178545.3-504s21c1
Sequence:CCGGCTACGATGAAGCTGTCAAGATCTCGAGATCTTGACAGCTTCATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178545
TMEM52 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 52
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178545.2-517s1c1
Sequence:CCGGCCTACGATGAAGCTGTCAAGACTCGAGTCTTGACAGCTTCATCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178545.2-641s1c1
Sequence:CCGGCAATACTCAACTACCACCTTGCTCGAGCAAGGTGGTAGTTGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178545.2-639s1c1
Sequence:CCGGCCCAATACTCAACTACCACCTCTCGAGAGGTGGTAGTTGAGTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178545.3-629s21c1
Sequence:CCGGATACTCAACTACCACCTTGTACTCGAGTACAAGGTGGTAGTTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178545.3-684s21c1
Sequence:CCGGACCAGAGCTTGGAGAACTAATCTCGAGATTAGTTCTCCAAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178545.3-371s21c1
Sequence:CCGGACAGCACTGTGACCTCCTACACTCGAGTGTAGGAGGTCACAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178545.3-660s21c1
Sequence:CCGGCCCTTGAAGGAGGTAGGAGAACTCGAGTTCTCCTACCTCCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178545.3-504s21c1
Sequence:CCGGCTACGATGAAGCTGTCAAGATCTCGAGATCTTGACAGCTTCATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks