EMAIL THIS PAGE TO A FRIEND

TMEM52B

transmembrane protein 52B

Synonyms: C12orf59
UniProtKB ID: Q4KMG9, Q96NA7
Gene ID:
Mouse(330428) transmembrane protein 52B
Rat(689963) transmembrane protein 52B
domestic cat(101086487) transmembrane protein 52B
domestic guinea pig(100725031) transmembrane protein 52B
naked mole-rat(101709361) transmembrane protein 52B
cow(618567) transmembrane protein 52B
sheep(101117658) transmembrane protein 52B
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153022 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153022 Rosetta Predictions human pricing
NM_001109560 Rosetta Predictions rat pricing
NM_001081186 Rosetta Predictions mouse pricing
XM_284236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191618 predicted 1118
2 SASI_Hs01_00191619 predicted 1410
3 SASI_Hs01_00191620 predicted 1301
4 SASI_Hs02_00366976 predicted 1377
5 SASI_Hs01_00191621 predicted 699
6 SASI_Hs01_00191622 predicted 1245
7 SASI_Hs01_00191623 predicted 1270
8 SASI_Hs02_00366977 predicted 1404
9 SASI_Hs01_00191624 predicted 1291
10 SASI_Hs01_00191625 predicted 1096
11 SASI_Hs01_00191616 predicted 1316
12 SASI_Hs01_00191617 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249591 predicted 969
2 SASI_Rn02_00249592 predicted 689
3 SASI_Rn02_00249593 predicted 765
4 SASI_Rn02_00249594 predicted 970
5 SASI_Rn02_00249595 predicted 811
6 SASI_Rn02_00249596 predicted 677
7 SASI_Rn02_00249597 predicted 945
8 SASI_Rn02_00249598 predicted 690
9 SASI_Rn02_00249599 predicted 684
10 SASI_Rn02_00249600 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296031 predicted 943
2 SASI_Mm02_00296032 predicted 1259
3 SASI_Mm02_00296033 predicted 1238
4 SASI_Mm02_00296034 predicted 1046
5 SASI_Mm02_00296035 predicted 1099
6 SASI_Mm02_00296036 predicted 1004
7 SASI_Mm02_00296037 predicted 737
8 SASI_Mm02_00296038 predicted 1211
9 SASI_Mm02_00296039 predicted 1326
10 SASI_Mm02_00296040 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250819 predicted 945
2 SASI_Mm01_00250820 predicted 1267
3 SASI_Mm01_00250821 predicted 1240
4 SASI_Mm01_00250822 predicted 1097
5 SASI_Mm01_00250823 predicted 1011
6 SASI_Mm01_00250824 predicted 741
7 SASI_Mm01_00250825 predicted 1209
8 SASI_Mm01_00250826 predicted 1338
9 SASI_Mm01_00250827 predicted 579
10 SASI_Mm01_00250828 predicted 1217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153022
TMEM52B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 52B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153022.2-1518s21c1
Sequence:CCGGTCAGCACAGCCATCGACATTACTCGAGTAATGTCGATGGCTGTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153022.1-905s1c1
Sequence:CCGGCCAGGGTATGAAGAAGCTCTTCTCGAGAAGAGCTTCTTCATACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153022.1-2075s1c1
Sequence:CCGGCGAGGAAGTGACGCACATTTACTCGAGTAAATGTGCGTCACTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153022.1-795s1c1
Sequence:CCGGGCACTATCACATCTCTGCAGTCTCGAGACTGCAGAGATGTGATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153022.1-1157s1c1
Sequence:CCGGCCATCATTCTATGGGAAAGATCTCGAGATCTTTCCCATAGAATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153022.1-1023s1c1
Sequence:CCGGCGACTCGAATAGTTGACTCTTCTCGAGAAGAGTCAACTATTCGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153022.1-926s1c1
Sequence:CCGGCACATGAGTCGCTTCACAGTACTCGAGTACTGTGAAGCGACTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153022
TMEM52B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 52B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153022.2-1518s21c1
Sequence:CCGGTCAGCACAGCCATCGACATTACTCGAGTAATGTCGATGGCTGTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153022.1-905s1c1
Sequence:CCGGCCAGGGTATGAAGAAGCTCTTCTCGAGAAGAGCTTCTTCATACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153022.1-2075s1c1
Sequence:CCGGCGAGGAAGTGACGCACATTTACTCGAGTAAATGTGCGTCACTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153022.1-795s1c1
Sequence:CCGGGCACTATCACATCTCTGCAGTCTCGAGACTGCAGAGATGTGATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153022.1-1157s1c1
Sequence:CCGGCCATCATTCTATGGGAAAGATCTCGAGATCTTTCCCATAGAATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153022.1-1023s1c1
Sequence:CCGGCGACTCGAATAGTTGACTCTTCTCGAGAAGAGTCAACTATTCGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153022.1-926s1c1
Sequence:CCGGCACATGAGTCGCTTCACAGTACTCGAGTACTGTGAAGCGACTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153022
TMEM52B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 52B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153022.2-1518s21c1
Sequence:CCGGTCAGCACAGCCATCGACATTACTCGAGTAATGTCGATGGCTGTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153022.1-905s1c1
Sequence:CCGGCCAGGGTATGAAGAAGCTCTTCTCGAGAAGAGCTTCTTCATACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153022.1-2075s1c1
Sequence:CCGGCGAGGAAGTGACGCACATTTACTCGAGTAAATGTGCGTCACTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153022.1-795s1c1
Sequence:CCGGGCACTATCACATCTCTGCAGTCTCGAGACTGCAGAGATGTGATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153022.1-1157s1c1
Sequence:CCGGCCATCATTCTATGGGAAAGATCTCGAGATCTTTCCCATAGAATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153022.1-1023s1c1
Sequence:CCGGCGACTCGAATAGTTGACTCTTCTCGAGAAGAGTCAACTATTCGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153022.1-926s1c1
Sequence:CCGGCACATGAGTCGCTTCACAGTACTCGAGTACTGTGAAGCGACTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081186
TMEM52B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 52B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081186.1-949s21c1
Sequence:CCGGGGCAGAAAGTTCCTGATTTACCTCGAGGTAAATCAGGAACTTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081186.1-1269s21c1
Sequence:CCGGCAACTCACCTTTAGCTATATTCTCGAGAATATAGCTAAAGGTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081186.1-739s21c1
Sequence:CCGGCTTATGAAGTGACTGTCATTGCTCGAGCAATGACAGTCACTTCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081186.1-796s21c1
Sequence:CCGGCATCTCTGCAGTCCGTGTTTGCTCGAGCAAACACGGACTGCAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081186.1-609s21c1
Sequence:CCGGTGGGTGCATCTCTGGTATATACTCGAGTATATACCAGAGATGCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081186
TMEM52B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 52B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081186.1-949s21c1
Sequence:CCGGGGCAGAAAGTTCCTGATTTACCTCGAGGTAAATCAGGAACTTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081186.1-1269s21c1
Sequence:CCGGCAACTCACCTTTAGCTATATTCTCGAGAATATAGCTAAAGGTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081186.1-739s21c1
Sequence:CCGGCTTATGAAGTGACTGTCATTGCTCGAGCAATGACAGTCACTTCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081186.1-796s21c1
Sequence:CCGGCATCTCTGCAGTCCGTGTTTGCTCGAGCAAACACGGACTGCAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081186.1-609s21c1
Sequence:CCGGTGGGTGCATCTCTGGTATATACTCGAGTATATACCAGAGATGCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081186
TMEM52B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 52B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081186.1-949s21c1
Sequence:CCGGGGCAGAAAGTTCCTGATTTACCTCGAGGTAAATCAGGAACTTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081186.1-1269s21c1
Sequence:CCGGCAACTCACCTTTAGCTATATTCTCGAGAATATAGCTAAAGGTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081186.1-739s21c1
Sequence:CCGGCTTATGAAGTGACTGTCATTGCTCGAGCAATGACAGTCACTTCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081186.1-796s21c1
Sequence:CCGGCATCTCTGCAGTCCGTGTTTGCTCGAGCAAACACGGACTGCAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081186.1-609s21c1
Sequence:CCGGTGGGTGCATCTCTGGTATATACTCGAGTATATACCAGAGATGCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks