EMAIL THIS PAGE TO A FRIEND

TMEM53

transmembrane protein 53

Synonyms: NET4
UniProtKB ID: Q6P2H8, B4DKG0, Q5JPH2, Q6IA07, Q9H6E2
Gene ID:
Mouse(68777) transmembrane protein 53
Rat(313529) transmembrane protein 53
cow(540738) transmembrane protein 53
sheep(101109235) transmembrane protein 53
naked mole-rat(101697134) transmembrane protein 53
domestic guinea pig(100725787) transmembrane protein 53
Zebrafish(436910) transmembrane protein 53
chicken(424581) transmembrane protein 53
domestic cat(101086915) transmembrane protein 53
dog(482522) transmembrane protein 53
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024587 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024587 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024587 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024587 Rosetta Predictions human pricing
NM_001107964 Rosetta Predictions rat pricing
NM_026837 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219462 predicted 928
2 SASI_Hs01_00219463 predicted 315
3 SASI_Hs01_00219464 predicted 933
4 SASI_Hs01_00219465 predicted 797
5 SASI_Hs01_00219466 predicted 381
6 SASI_Hs01_00219467 predicted 357
7 SASI_Hs01_00219468 predicted 883
8 SASI_Hs01_00219469 predicted 690
9 SASI_Hs01_00219470 predicted 692
10 SASI_Hs02_00356923 predicted 874
11 SASI_Hs01_00219471 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234025 predicted 420
2 SASI_Rn02_00234026 predicted 327
3 SASI_Rn02_00234027 predicted 465
4 SASI_Rn02_00234028 predicted 231
5 SASI_Rn02_00234029 predicted 846
6 SASI_Rn02_00234030 predicted 876
7 SASI_Rn02_00234031 predicted 710
8 SASI_Rn02_00234032 predicted 859
9 SASI_Rn02_00234033 predicted 864
10 SASI_Rn02_00234034 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331017 predicted 416
2 SASI_Mm02_00331018 predicted 226
3 SASI_Mm02_00331019 predicted 717
4 SASI_Mm02_00331020 predicted 592
5 SASI_Mm02_00331021 predicted 320
6 SASI_Mm02_00331022 predicted 326
7 SASI_Mm02_00331023 predicted 608
8 SASI_Mm02_00331024 predicted 304
9 SASI_Mm02_00331025 predicted 655
10 SASI_Mm02_00331026 predicted 720
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024587
VALIDATED
TMEM53 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 53
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024587.2-627s1c1
Sequence:CCGGCCACTTCTATGACAGGCTACACTCGAGTGTAGCCTGTCATAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024587.2-281s1c1
Sequence:CCGGGTATCCCTTCACTTCGTGTTTCTCGAGAAACACGAAGTGAAGGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024587.2-321s1c1
Sequence:CCGGGCTGCTCTTTGATTATGAGATCTCGAGATCTCATAATCAAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024587.2-174s1c1
Sequence:CCGGCAAGGACAAGAACCTTGCCAACTCGAGTTGGCAAGGTTCTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-454s21c1
Sequence:CCGGACCATCTTTGACAGCGCTCCTCTCGAGAGGAGCGCTGTCAAAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-220s21c1
Sequence:CCGGGGCTGCATCGTAATCCGATACCTCGAGGTATCGGATTACGATGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024587.2-1198s21c1
Sequence:CCGGAGGGTGAGCCCTAGTTGATTTCTCGAGAAATCAACTAGGGCTCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-827s21c1
Sequence:CCGGCAAGCCTCTGTGTCGACTTCACTCGAGTGAAGTCGACACAGAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024587.2-964s21c1
Sequence:CCGGCTGTAGCCCTTTGGGACTTTGCTCGAGCAAAGTCCCAAAGGGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-704s21c1
Sequence:CCGGTCCTGGCCAGAGACATAGAACCTCGAGGTTCTATGTCTCTGGCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-715s21c1
Sequence:CCGGGACATAGAACGCATGGTGGAGCTCGAGCTCCACCATGCGTTCTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-362s21c1
Sequence:CCGGTCCATGTCTTCAGCAACGGTGCTCGAGCACCGTTGCTGAAGACATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024587
VALIDATED
TMEM53 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 53
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024587.2-627s1c1
Sequence:CCGGCCACTTCTATGACAGGCTACACTCGAGTGTAGCCTGTCATAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024587.2-281s1c1
Sequence:CCGGGTATCCCTTCACTTCGTGTTTCTCGAGAAACACGAAGTGAAGGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024587.2-321s1c1
Sequence:CCGGGCTGCTCTTTGATTATGAGATCTCGAGATCTCATAATCAAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024587.2-174s1c1
Sequence:CCGGCAAGGACAAGAACCTTGCCAACTCGAGTTGGCAAGGTTCTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-454s21c1
Sequence:CCGGACCATCTTTGACAGCGCTCCTCTCGAGAGGAGCGCTGTCAAAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-220s21c1
Sequence:CCGGGGCTGCATCGTAATCCGATACCTCGAGGTATCGGATTACGATGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024587.2-1198s21c1
Sequence:CCGGAGGGTGAGCCCTAGTTGATTTCTCGAGAAATCAACTAGGGCTCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-827s21c1
Sequence:CCGGCAAGCCTCTGTGTCGACTTCACTCGAGTGAAGTCGACACAGAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024587.2-964s21c1
Sequence:CCGGCTGTAGCCCTTTGGGACTTTGCTCGAGCAAAGTCCCAAAGGGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-704s21c1
Sequence:CCGGTCCTGGCCAGAGACATAGAACCTCGAGGTTCTATGTCTCTGGCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-715s21c1
Sequence:CCGGGACATAGAACGCATGGTGGAGCTCGAGCTCCACCATGCGTTCTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-362s21c1
Sequence:CCGGTCCATGTCTTCAGCAACGGTGCTCGAGCACCGTTGCTGAAGACATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024587
VALIDATED
TMEM53 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 53
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024587.2-627s1c1
Sequence:CCGGCCACTTCTATGACAGGCTACACTCGAGTGTAGCCTGTCATAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024587.2-281s1c1
Sequence:CCGGGTATCCCTTCACTTCGTGTTTCTCGAGAAACACGAAGTGAAGGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024587.2-321s1c1
Sequence:CCGGGCTGCTCTTTGATTATGAGATCTCGAGATCTCATAATCAAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024587.2-174s1c1
Sequence:CCGGCAAGGACAAGAACCTTGCCAACTCGAGTTGGCAAGGTTCTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-454s21c1
Sequence:CCGGACCATCTTTGACAGCGCTCCTCTCGAGAGGAGCGCTGTCAAAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-220s21c1
Sequence:CCGGGGCTGCATCGTAATCCGATACCTCGAGGTATCGGATTACGATGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024587.2-1198s21c1
Sequence:CCGGAGGGTGAGCCCTAGTTGATTTCTCGAGAAATCAACTAGGGCTCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-827s21c1
Sequence:CCGGCAAGCCTCTGTGTCGACTTCACTCGAGTGAAGTCGACACAGAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024587.2-964s21c1
Sequence:CCGGCTGTAGCCCTTTGGGACTTTGCTCGAGCAAAGTCCCAAAGGGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-704s21c1
Sequence:CCGGTCCTGGCCAGAGACATAGAACCTCGAGGTTCTATGTCTCTGGCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-715s21c1
Sequence:CCGGGACATAGAACGCATGGTGGAGCTCGAGCTCCACCATGCGTTCTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024587.2-362s21c1
Sequence:CCGGTCCATGTCTTCAGCAACGGTGCTCGAGCACCGTTGCTGAAGACATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026837
VALIDATED
TMEM53 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 53
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026837.1-365s1c1
Sequence:CCGGGCTCCTCTTTGACTATGAGATCTCGAGATCTCATAGTCAAAGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026837.1-222s1c1
Sequence:CCGGGACAAGAACCTGGCCAAGTATCTCGAGATACTTGGCCAGGTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026837.1-230s1c1
Sequence:CCGGCCTGGCCAAGTATAGTGCTATCTCGAGATAGCACTATACTTGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026837.1-296s1c1
Sequence:CCGGGCACATGGTCTTCTTCTCTGACTCGAGTCAGAGAAGAAGACCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026837.1-239s1c1
Sequence:CCGGGTATAGTGCTATCTACCACAACTCGAGTTGTGGTAGATAGCACTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-179s21c1
Sequence:CCGGCAACAGCCTGTGGTGATTCTCCTCGAGGAGAATCACCACAGGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-594s21c1
Sequence:CCGGTGTTGCTCCTGGCAGCATTTGCTCGAGCAAATGCTGCCAGGAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-327s21c1
Sequence:CCGGTCCCTTCACTTCGCGTGATAGCTCGAGCTATCACGCGAAGTGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-519s21c1
Sequence:CCGGCTGGCGATAGCAACCTGATAGCTCGAGCTATCAGGTTGCTATCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-263s21c2
Sequence:CCGGGGCTGCATTGTGATCCGATACCTCGAGGTATCGGATCACAATGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026837.2-238s21c1
Sequence:CCGGGTATAGTGCTATCTACCACAACTCGAGTTGTGGTAGATAGCACTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026837
VALIDATED
TMEM53 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 53
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026837.1-365s1c1
Sequence:CCGGGCTCCTCTTTGACTATGAGATCTCGAGATCTCATAGTCAAAGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026837.1-222s1c1
Sequence:CCGGGACAAGAACCTGGCCAAGTATCTCGAGATACTTGGCCAGGTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026837.1-230s1c1
Sequence:CCGGCCTGGCCAAGTATAGTGCTATCTCGAGATAGCACTATACTTGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026837.1-296s1c1
Sequence:CCGGGCACATGGTCTTCTTCTCTGACTCGAGTCAGAGAAGAAGACCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026837.1-239s1c1
Sequence:CCGGGTATAGTGCTATCTACCACAACTCGAGTTGTGGTAGATAGCACTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-179s21c1
Sequence:CCGGCAACAGCCTGTGGTGATTCTCCTCGAGGAGAATCACCACAGGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-594s21c1
Sequence:CCGGTGTTGCTCCTGGCAGCATTTGCTCGAGCAAATGCTGCCAGGAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-327s21c1
Sequence:CCGGTCCCTTCACTTCGCGTGATAGCTCGAGCTATCACGCGAAGTGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-519s21c1
Sequence:CCGGCTGGCGATAGCAACCTGATAGCTCGAGCTATCAGGTTGCTATCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-263s21c2
Sequence:CCGGGGCTGCATTGTGATCCGATACCTCGAGGTATCGGATCACAATGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026837.2-238s21c1
Sequence:CCGGGTATAGTGCTATCTACCACAACTCGAGTTGTGGTAGATAGCACTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026837
VALIDATED
TMEM53 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 53
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026837.1-365s1c1
Sequence:CCGGGCTCCTCTTTGACTATGAGATCTCGAGATCTCATAGTCAAAGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026837.1-222s1c1
Sequence:CCGGGACAAGAACCTGGCCAAGTATCTCGAGATACTTGGCCAGGTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026837.1-230s1c1
Sequence:CCGGCCTGGCCAAGTATAGTGCTATCTCGAGATAGCACTATACTTGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026837.1-296s1c1
Sequence:CCGGGCACATGGTCTTCTTCTCTGACTCGAGTCAGAGAAGAAGACCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026837.1-239s1c1
Sequence:CCGGGTATAGTGCTATCTACCACAACTCGAGTTGTGGTAGATAGCACTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-179s21c1
Sequence:CCGGCAACAGCCTGTGGTGATTCTCCTCGAGGAGAATCACCACAGGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-594s21c1
Sequence:CCGGTGTTGCTCCTGGCAGCATTTGCTCGAGCAAATGCTGCCAGGAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-327s21c1
Sequence:CCGGTCCCTTCACTTCGCGTGATAGCTCGAGCTATCACGCGAAGTGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-519s21c1
Sequence:CCGGCTGGCGATAGCAACCTGATAGCTCGAGCTATCAGGTTGCTATCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026837.2-263s21c2
Sequence:CCGGGGCTGCATTGTGATCCGATACCTCGAGGTATCGGATCACAATGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026837.2-238s21c1
Sequence:CCGGGTATAGTGCTATCTACCACAACTCGAGTTGTGGTAGATAGCACTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks