EMAIL THIS PAGE TO A FRIEND

TMEM54

transmembrane protein 54

Synonyms: BCLP CAC-1 CAC1
UniProtKB ID: Q969K7, Q6UV18, Q8IVD0, Q9UM12
Gene ID:
Mouse(66260) transmembrane protein 54
Rat(362605) transmembrane protein 54
Zebrafish(557625) transmembrane protein 54
domestic cat(101080984) transmembrane protein 54
dog(611785) transmembrane protein 54
domestic guinea pig(100726562) transmembrane protein 54
naked mole-rat(101726159) transmembrane protein 54
cow(509773) transmembrane protein 54
sheep(101111346) transmembrane protein 54
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033504 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033504 Rosetta Predictions human pricing
NM_001034151 Rosetta Predictions rat pricing
NM_025452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047165 predicted 764
2 SASI_Hs01_00047166 predicted 286
3 SASI_Hs01_00047167 predicted 218
4 SASI_Hs01_00047168 predicted 314
5 SASI_Hs01_00047169 predicted 346
6 SASI_Hs01_00047172 predicted 296
7 SASI_Hs02_00361375 predicted 564
8 SASI_Hs01_00047173 predicted 254
9 SASI_Hs01_00047174 predicted 276
10 SASI_Hs02_00361376 predicted 340
11 SASI_Hs01_00047170 predicted 413
12 SASI_Hs01_00047171 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122075 predicted 357
2 SASI_Rn01_00122076 predicted 399
3 SASI_Rn02_00204009 predicted 355
4 SASI_Rn01_00122077 predicted 745
5 SASI_Rn01_00122079 predicted 345
6 SASI_Rn01_00122080 predicted 792
7 SASI_Rn01_00122081 predicted 330
8 SASI_Rn01_00122083 predicted 301
9 SASI_Rn01_00122084 predicted 274
10 SASI_Rn02_00204010 predicted 558
11 SASI_Rn01_00122078 predicted 707
12 SASI_Rn01_00122082 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054706 predicted 274
2 SASI_Mm01_00054707 predicted 303
3 SASI_Mm01_00054708 predicted 461
4 SASI_Mm01_00054709 predicted 373
5 SASI_Mm01_00054710 predicted 331
6 SASI_Mm01_00054711 predicted 532
7 SASI_Mm01_00054712 predicted 476
8 SASI_Mm01_00054713 predicted 721
9 SASI_Mm01_00054714 predicted 245
10 SASI_Mm01_00054715 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033504
VALIDATED
TMEM54 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 54
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-151s21c1
Sequence:CCGGTTCCGGAAGGTGCTGATGAAGCTCGAGCTTCATCAGCACCTTCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-814s21c1
Sequence:CCGGACTAGGACCCTGCAAGCAACTCTCGAGAGTTGCTTGCAGGGTCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-348s21c1
Sequence:CCGGCATCGTGTTGTCACGCTACCTCTCGAGAGGTAGCGTGACAACACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-773s21c1
Sequence:CCGGTGACCCTCTGAGAGATGATGTCTCGAGACATCATCTCTCAGAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-279s21c1
Sequence:CCGGGCAGTACTGCGTGGTCAACATCTCGAGATGTTGACCACGCAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033504
VALIDATED
TMEM54 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 54
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-151s21c1
Sequence:CCGGTTCCGGAAGGTGCTGATGAAGCTCGAGCTTCATCAGCACCTTCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-814s21c1
Sequence:CCGGACTAGGACCCTGCAAGCAACTCTCGAGAGTTGCTTGCAGGGTCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-348s21c1
Sequence:CCGGCATCGTGTTGTCACGCTACCTCTCGAGAGGTAGCGTGACAACACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-773s21c1
Sequence:CCGGTGACCCTCTGAGAGATGATGTCTCGAGACATCATCTCTCAGAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-279s21c1
Sequence:CCGGGCAGTACTGCGTGGTCAACATCTCGAGATGTTGACCACGCAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033504
VALIDATED
TMEM54 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 54
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-151s21c1
Sequence:CCGGTTCCGGAAGGTGCTGATGAAGCTCGAGCTTCATCAGCACCTTCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-814s21c1
Sequence:CCGGACTAGGACCCTGCAAGCAACTCTCGAGAGTTGCTTGCAGGGTCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-348s21c1
Sequence:CCGGCATCGTGTTGTCACGCTACCTCTCGAGAGGTAGCGTGACAACACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-773s21c1
Sequence:CCGGTGACCCTCTGAGAGATGATGTCTCGAGACATCATCTCTCAGAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033504.2-279s21c1
Sequence:CCGGGCAGTACTGCGTGGTCAACATCTCGAGATGTTGACCACGCAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025452
TMEM54 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 54
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-464s1c1
Sequence:CCGGCACCAAGGGTAGAGCACTATTCTCGAGAATAGTGCTCTACCCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-547s1c1
Sequence:CCGGCTACTCGAATTTATAGCTCTACTCGAGTAGAGCTATAAATTCGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-643s1c1
Sequence:CCGGTGCATGGACTACTGGAACTAACTCGAGTTAGTTCCAGTAGTCCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-317s1c1
Sequence:CCGGTGTTGCAGGAATTTCGACCATCTCGAGATGGTCGAAATTCCTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-323s1c1
Sequence:CCGGAGGAATTTCGACCATCGTCTTCTCGAGAAGACGATGGTCGAAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025452
TMEM54 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 54
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-464s1c1
Sequence:CCGGCACCAAGGGTAGAGCACTATTCTCGAGAATAGTGCTCTACCCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-547s1c1
Sequence:CCGGCTACTCGAATTTATAGCTCTACTCGAGTAGAGCTATAAATTCGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-643s1c1
Sequence:CCGGTGCATGGACTACTGGAACTAACTCGAGTTAGTTCCAGTAGTCCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-317s1c1
Sequence:CCGGTGTTGCAGGAATTTCGACCATCTCGAGATGGTCGAAATTCCTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-323s1c1
Sequence:CCGGAGGAATTTCGACCATCGTCTTCTCGAGAAGACGATGGTCGAAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025452
TMEM54 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 54
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-464s1c1
Sequence:CCGGCACCAAGGGTAGAGCACTATTCTCGAGAATAGTGCTCTACCCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-547s1c1
Sequence:CCGGCTACTCGAATTTATAGCTCTACTCGAGTAGAGCTATAAATTCGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-643s1c1
Sequence:CCGGTGCATGGACTACTGGAACTAACTCGAGTTAGTTCCAGTAGTCCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-317s1c1
Sequence:CCGGTGTTGCAGGAATTTCGACCATCTCGAGATGGTCGAAATTCCTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025452.2-323s1c1
Sequence:CCGGAGGAATTTCGACCATCGTCTTCTCGAGAAGACGATGGTCGAAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks