EMAIL THIS PAGE TO A FRIEND

TMEM55A

transmembrane protein 55A

UniProtKB ID: Q8N4L2, B2R9H4, Q68CU2
Gene ID:
Human(55529) Summary: TMEM55A catalyzes the degradation of phosphatidylinositol 4,5-bisphosphate (PtdIns-4,5-P2) by removing the 4-phosphate (Ungewickell et al., 2005 [PubMed 16365287]
Mouse(72519) transmembrane protein 55A
Rat(362490) transmembrane protein 55A
cow(616641) transmembrane protein 55A
sheep(101111559) transmembrane protein 55A
naked mole-rat(101718072) transmembrane protein 55A
domestic guinea pig(100713718) transmembrane protein 55A
Zebrafish(566642) transmembrane protein 55A
chicken(420221) transmembrane protein 55A
domestic cat(101088301) transmembrane protein 55A
dog(477939) transmembrane protein 55A
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018710 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018710 Rosetta Predictions human pricing
NM_001024900 Rosetta Predictions rat pricing
NM_028264 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352240 predicted 424
2 SASI_Hs01_00219032 predicted 777
3 SASI_Hs01_00219033 predicted 748
4 SASI_Hs01_00219034 predicted 895
5 SASI_Hs01_00219035 predicted 875
6 SASI_Hs01_00219036 predicted 356
7 SASI_Hs01_00219037 predicted 725
8 SASI_Hs01_00219038 predicted 568
9 SASI_Hs01_00219039 predicted 263
10 SASI_Hs01_00219041 predicted 948
11 SASI_Hs01_00219040 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069168 predicted 346
2 SASI_Rn01_00069169 predicted 822
3 SASI_Rn01_00069170 predicted 248
4 SASI_Rn01_00069172 predicted 801
5 SASI_Rn02_00202801 predicted 224
6 SASI_Rn01_00069173 predicted 711
7 SASI_Rn01_00069174 predicted 642
8 SASI_Rn01_00069175 predicted 279
9 SASI_Rn01_00069176 predicted 381
10 SASI_Rn02_00202802 predicted 396
11 SASI_Rn01_00069167 predicted 738
12 SASI_Rn01_00069171 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100938 predicted 881
2 SASI_Mm01_00100939 predicted 463
3 SASI_Mm01_00100940 predicted 399
4 SASI_Mm01_00100941 predicted 427
5 SASI_Mm01_00100942 predicted 691
6 SASI_Mm01_00100943 predicted 787
7 SASI_Mm01_00100944 predicted 296
8 SASI_Mm01_00100945 predicted 764
9 SASI_Mm01_00100946 predicted 417
10 SASI_Mm01_00100947 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018710
VALIDATED
TMEM55A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 55A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018710.1-191s1c1
Sequence:CCGGCCACCTCCATATACAGCCATTCTCGAGAATGGCTGTATATGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018710.1-431s1c1
Sequence:CCGGCCCAACTGTAGACGGATAATTCTCGAGAATTATCCGTCTACAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018710.1-574s1c1
Sequence:CCGGGAGGTTCAACACTCTGGCAAACTCGAGTTTGCCAGAGTGTTGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018710.1-254s1c1
Sequence:CCGGGTGTGCCAATCACTAATCAATCTCGAGATTGATTAGTGATTGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018710.1-347s1c1
Sequence:CCGGCCAACAGGCAAGAAATATGTTCTCGAGAACATATTTCTTGCCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018710.1-732s1c1
Sequence:CCGGGATTTCGAGCAACCTATGTTTCTCGAGAAACATAGGTTGCTCGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018710.1-318s1c1
Sequence:CCGGGCAATGAAGCTACGCCAATCACTCGAGTGATTGGCGTAGCTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018710.2-513s21c1
Sequence:CCGGATGTTAGATGCCCTTGTAATTCTCGAGAATTACAAGGGCATCTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018710.2-301s21c1
Sequence:CCGGCCCACCGTACTTGCAAGAAAGCTCGAGCTTTCTTGCAAGTACGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018710.2-1329s21c1
Sequence:CCGGATGAGTATTCCTAAGTGTTTACTCGAGTAAACACTTAGGAATACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018710.2-1086s21c1
Sequence:CCGGATGGATTCCATTCTGGTTTATCTCGAGATAAACCAGAATGGAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018710
VALIDATED
TMEM55A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 55A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018710.1-191s1c1
Sequence:CCGGCCACCTCCATATACAGCCATTCTCGAGAATGGCTGTATATGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018710.1-431s1c1
Sequence:CCGGCCCAACTGTAGACGGATAATTCTCGAGAATTATCCGTCTACAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018710.1-574s1c1
Sequence:CCGGGAGGTTCAACACTCTGGCAAACTCGAGTTTGCCAGAGTGTTGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018710.1-254s1c1
Sequence:CCGGGTGTGCCAATCACTAATCAATCTCGAGATTGATTAGTGATTGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018710.1-347s1c1
Sequence:CCGGCCAACAGGCAAGAAATATGTTCTCGAGAACATATTTCTTGCCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018710.1-732s1c1
Sequence:CCGGGATTTCGAGCAACCTATGTTTCTCGAGAAACATAGGTTGCTCGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018710.1-318s1c1
Sequence:CCGGGCAATGAAGCTACGCCAATCACTCGAGTGATTGGCGTAGCTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018710.2-513s21c1
Sequence:CCGGATGTTAGATGCCCTTGTAATTCTCGAGAATTACAAGGGCATCTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018710.2-301s21c1
Sequence:CCGGCCCACCGTACTTGCAAGAAAGCTCGAGCTTTCTTGCAAGTACGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018710.2-1329s21c1
Sequence:CCGGATGAGTATTCCTAAGTGTTTACTCGAGTAAACACTTAGGAATACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018710.2-1086s21c1
Sequence:CCGGATGGATTCCATTCTGGTTTATCTCGAGATAAACCAGAATGGAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018710
VALIDATED
TMEM55A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 55A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018710.1-191s1c1
Sequence:CCGGCCACCTCCATATACAGCCATTCTCGAGAATGGCTGTATATGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018710.1-431s1c1
Sequence:CCGGCCCAACTGTAGACGGATAATTCTCGAGAATTATCCGTCTACAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018710.1-574s1c1
Sequence:CCGGGAGGTTCAACACTCTGGCAAACTCGAGTTTGCCAGAGTGTTGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018710.1-254s1c1
Sequence:CCGGGTGTGCCAATCACTAATCAATCTCGAGATTGATTAGTGATTGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018710.1-347s1c1
Sequence:CCGGCCAACAGGCAAGAAATATGTTCTCGAGAACATATTTCTTGCCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018710.1-732s1c1
Sequence:CCGGGATTTCGAGCAACCTATGTTTCTCGAGAAACATAGGTTGCTCGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018710.1-318s1c1
Sequence:CCGGGCAATGAAGCTACGCCAATCACTCGAGTGATTGGCGTAGCTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018710.2-513s21c1
Sequence:CCGGATGTTAGATGCCCTTGTAATTCTCGAGAATTACAAGGGCATCTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018710.2-301s21c1
Sequence:CCGGCCCACCGTACTTGCAAGAAAGCTCGAGCTTTCTTGCAAGTACGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018710.2-1329s21c1
Sequence:CCGGATGAGTATTCCTAAGTGTTTACTCGAGTAAACACTTAGGAATACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018710.2-1086s21c1
Sequence:CCGGATGGATTCCATTCTGGTTTATCTCGAGATAAACCAGAATGGAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028264
VALIDATED
TMEM55A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 55A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028264.2-768s1c1
Sequence:CCGGGCGATTTCATGCAACCTATGTCTCGAGACATAGGTTGCATGAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028264.2-803s1c1
Sequence:CCGGCTTATCTGCTAGGTTTGATTTCTCGAGAAATCAAACCTAGCAGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028264.2-298s1c1
Sequence:CCGGCAATCTCTAATCAACCTGGATCTCGAGATCCAGGTTGATTAGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028264.4-412s1c1
Sequence:CCGGCTTGTAATTGTCTACTCATTTCTCGAGAAATGAGTAGACAATTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028264.4-948s1c1
Sequence:CCGGGGACGCCTTCAAATCATTTATCTCGAGATAAATGATTTGAAGGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028264.4-468s21c1
Sequence:CCGGCCCAACTGTCGACGCATAATTCTCGAGAATTATGCGTCGACAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028264.4-153s21c1
Sequence:CCGGTCAGCATCCCATTCGGGAAATCTCGAGATTTCCCGAATGGGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028264.4-412s21c1
Sequence:CCGGCTTGTAATTGTCTACTCATTTCTCGAGAAATGAGTAGACAATTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028264.4-846s21c1
Sequence:CCGGGGCGCAATCAGAGTCAGTTATCTCGAGATAACTGACTCTGATTGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028264.4-1139s21c1
Sequence:CCGGATTTGTCCTCCCACGTTATATCTCGAGATATAACGTGGGAGGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028264
VALIDATED
TMEM55A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 55A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028264.2-768s1c1
Sequence:CCGGGCGATTTCATGCAACCTATGTCTCGAGACATAGGTTGCATGAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028264.2-803s1c1
Sequence:CCGGCTTATCTGCTAGGTTTGATTTCTCGAGAAATCAAACCTAGCAGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028264.2-298s1c1
Sequence:CCGGCAATCTCTAATCAACCTGGATCTCGAGATCCAGGTTGATTAGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028264.4-412s1c1
Sequence:CCGGCTTGTAATTGTCTACTCATTTCTCGAGAAATGAGTAGACAATTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028264.4-948s1c1
Sequence:CCGGGGACGCCTTCAAATCATTTATCTCGAGATAAATGATTTGAAGGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028264.4-468s21c1
Sequence:CCGGCCCAACTGTCGACGCATAATTCTCGAGAATTATGCGTCGACAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028264.4-153s21c1
Sequence:CCGGTCAGCATCCCATTCGGGAAATCTCGAGATTTCCCGAATGGGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028264.4-412s21c1
Sequence:CCGGCTTGTAATTGTCTACTCATTTCTCGAGAAATGAGTAGACAATTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028264.4-846s21c1
Sequence:CCGGGGCGCAATCAGAGTCAGTTATCTCGAGATAACTGACTCTGATTGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028264.4-1139s21c1
Sequence:CCGGATTTGTCCTCCCACGTTATATCTCGAGATATAACGTGGGAGGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028264
VALIDATED
TMEM55A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 55A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028264.2-768s1c1
Sequence:CCGGGCGATTTCATGCAACCTATGTCTCGAGACATAGGTTGCATGAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028264.2-803s1c1
Sequence:CCGGCTTATCTGCTAGGTTTGATTTCTCGAGAAATCAAACCTAGCAGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028264.2-298s1c1
Sequence:CCGGCAATCTCTAATCAACCTGGATCTCGAGATCCAGGTTGATTAGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028264.4-412s1c1
Sequence:CCGGCTTGTAATTGTCTACTCATTTCTCGAGAAATGAGTAGACAATTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028264.4-948s1c1
Sequence:CCGGGGACGCCTTCAAATCATTTATCTCGAGATAAATGATTTGAAGGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028264.4-468s21c1
Sequence:CCGGCCCAACTGTCGACGCATAATTCTCGAGAATTATGCGTCGACAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028264.4-153s21c1
Sequence:CCGGTCAGCATCCCATTCGGGAAATCTCGAGATTTCCCGAATGGGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028264.4-412s21c1
Sequence:CCGGCTTGTAATTGTCTACTCATTTCTCGAGAAATGAGTAGACAATTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028264.4-846s21c1
Sequence:CCGGGGCGCAATCAGAGTCAGTTATCTCGAGATAACTGACTCTGATTGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028264.4-1139s21c1
Sequence:CCGGATTTGTCCTCCCACGTTATATCTCGAGATATAACGTGGGAGGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks