EMAIL THIS PAGE TO A FRIEND

TMEM55B

transmembrane protein 55B

Synonyms: C14orf9
UniProtKB ID: Q86T03, B2RA35, Q86U09, Q8WUC0, Q9BU67, Q9NSU8
Gene ID:
Human(90809) Summary: TMEM55B catalyzes the degradation of phosphatidylinositol 4,5-bisphosphate (PtdIns-4,5-P2) by removing the 4-phosphate (Ungewickell et al., 2005 [PubMed 16365287]
Mouse(219024) transmembrane protein 55b
Rat(364298) transmembrane protein 55B
domestic cat(101080798) transmembrane protein 55B
dog(482559) transmembrane protein 55B
domestic guinea pig(100718609) transmembrane protein 55B
naked mole-rat(101709122) transmembrane protein 55B
cow(615077) transmembrane protein 55B
sheep(101117510) transmembrane protein 55B
131 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144568 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033271 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033271 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033271 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100814 Rosetta Predictions human pricing
NM_144568 Rosetta Predictions human pricing
NM_001014233 Rosetta Predictions rat pricing
NM_001033271 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322347 predicted 1313
2 SASI_Hs02_00322348 predicted 933
3 SASI_Hs02_00322349 predicted 1395
4 SASI_Hs02_00322350 predicted 779
5 SASI_Hs02_00322351 predicted 887
6 SASI_Hs02_00322352 predicted 735
7 SASI_Hs02_00322353 predicted 1175
8 SASI_Hs02_00322354 predicted 1378
9 SASI_Hs02_00322355 predicted 948
10 SASI_Hs02_00322356 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364337 predicted 1291
2 SASI_Hs01_00184076 predicted 917
3 SASI_Hs02_00364338 predicted 1376
4 SASI_Hs02_00364339 predicted 763
5 SASI_Hs01_00184077 predicted 864
6 SASI_Hs01_00184079 predicted 714
7 SASI_Hs01_00184080 predicted 1161
8 SASI_Hs01_00184082 predicted 1354
9 SASI_Hs02_00364340 predicted 929
10 SASI_Hs01_00184084 predicted 1296
11 SASI_Hs01_00184078 predicted 1189
12 SASI_Hs01_00184081 predicted 753
13 SASI_Hs01_00184083 predicted 355
14 SASI_Hs01_00184085 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098759 predicted 717
2 SASI_Rn01_00098760 predicted 1149
3 SASI_Rn01_00098761 predicted 838
4 SASI_Rn01_00098762 predicted 1036
5 SASI_Rn02_00201774 predicted 389
6 SASI_Rn01_00098764 predicted 769
7 SASI_Rn02_00201775 predicted 639
8 SASI_Rn01_00098765 predicted 1240
9 SASI_Rn01_00098766 predicted 648
10 SASI_Rn01_00098767 predicted 776
11 SASI_Rn01_00098758 predicted 500
12 SASI_Rn01_00098763 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033271 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082095 predicted 685
2 SASI_Mm01_00082096 predicted 1212
3 SASI_Mm01_00082097 predicted 356
4 SASI_Mm01_00082098 predicted 630
5 SASI_Mm02_00288459 predicted 1004
6 SASI_Mm01_00082099 predicted 1344
7 SASI_Mm01_00082100 predicted 748
8 SASI_Mm01_00082101 predicted 601
9 SASI_Mm02_00288460 predicted 385
10 SASI_Mm01_00082102 predicted 372
11 SASI_Mm01_00082103 predicted 401
12 SASI_Mm01_00082104 predicted 1073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144568
TMEM55B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 55B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144568.2-754s21c1
Sequence:CCGGTCATCTATTGGGCGCAGATACCTCGAGGTATCTGCGCCCAATAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144568.2-866s21c1
Sequence:CCGGGGCGATATGGAGGCATCTATGCTCGAGCATAGATGCCTCCATATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144568.2-443s21c1
Sequence:CCGGTGCATCAGCATGTAGTCAAATCTCGAGATTTGACTACATGCTGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-413s1c1
Sequence:CCGGCCAATCTCTCATCAACGTGGACTCGAGTCCACGTTGATGAGAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160106    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144568.1-1539s1c1
Sequence:CCGGCCTATTCCTGTATTTCCCTTACTCGAGTAAGGGAAATACAGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-449s1c1
Sequence:CCGGGCATGTAGTCAAATGTGGTGTCTCGAGACACCACATTTGACTACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-414s1c1
Sequence:CCGGCAATCTCTCATCAACGTGGAACTCGAGTTCCACGTTGATGAGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-766s1c1
Sequence:CCGGGCAGATACACACGTAAGAGATCTCGAGATCTCTTACGTGTGTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-934s1c1
Sequence:CCGGCTCTTTATTGGGCCTGTATGACTCGAGTCATACAGGCCCAATAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-796s1c1
Sequence:CCGGGCTTCTTGCTTGGCTTGCTTTCTCGAGAAAGCAAGCCAAGCAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-551s1c1
Sequence:CCGGCAAAGTGACATCCCAACGGATCTCGAGATCCGTTGGGATGTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144568
TMEM55B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 55B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144568.2-754s21c1
Sequence:CCGGTCATCTATTGGGCGCAGATACCTCGAGGTATCTGCGCCCAATAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144568.2-866s21c1
Sequence:CCGGGGCGATATGGAGGCATCTATGCTCGAGCATAGATGCCTCCATATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144568.2-443s21c1
Sequence:CCGGTGCATCAGCATGTAGTCAAATCTCGAGATTTGACTACATGCTGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-413s1c1
Sequence:CCGGCCAATCTCTCATCAACGTGGACTCGAGTCCACGTTGATGAGAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160106    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144568.1-1539s1c1
Sequence:CCGGCCTATTCCTGTATTTCCCTTACTCGAGTAAGGGAAATACAGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-449s1c1
Sequence:CCGGGCATGTAGTCAAATGTGGTGTCTCGAGACACCACATTTGACTACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-414s1c1
Sequence:CCGGCAATCTCTCATCAACGTGGAACTCGAGTTCCACGTTGATGAGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-766s1c1
Sequence:CCGGGCAGATACACACGTAAGAGATCTCGAGATCTCTTACGTGTGTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-934s1c1
Sequence:CCGGCTCTTTATTGGGCCTGTATGACTCGAGTCATACAGGCCCAATAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-796s1c1
Sequence:CCGGGCTTCTTGCTTGGCTTGCTTTCTCGAGAAAGCAAGCCAAGCAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-551s1c1
Sequence:CCGGCAAAGTGACATCCCAACGGATCTCGAGATCCGTTGGGATGTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144568
TMEM55B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 55B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144568.2-754s21c1
Sequence:CCGGTCATCTATTGGGCGCAGATACCTCGAGGTATCTGCGCCCAATAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144568.2-866s21c1
Sequence:CCGGGGCGATATGGAGGCATCTATGCTCGAGCATAGATGCCTCCATATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144568.2-443s21c1
Sequence:CCGGTGCATCAGCATGTAGTCAAATCTCGAGATTTGACTACATGCTGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-413s1c1
Sequence:CCGGCCAATCTCTCATCAACGTGGACTCGAGTCCACGTTGATGAGAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160106    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144568.1-1539s1c1
Sequence:CCGGCCTATTCCTGTATTTCCCTTACTCGAGTAAGGGAAATACAGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-449s1c1
Sequence:CCGGGCATGTAGTCAAATGTGGTGTCTCGAGACACCACATTTGACTACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-414s1c1
Sequence:CCGGCAATCTCTCATCAACGTGGAACTCGAGTTCCACGTTGATGAGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-766s1c1
Sequence:CCGGGCAGATACACACGTAAGAGATCTCGAGATCTCTTACGTGTGTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-934s1c1
Sequence:CCGGCTCTTTATTGGGCCTGTATGACTCGAGTCATACAGGCCCAATAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-796s1c1
Sequence:CCGGGCTTCTTGCTTGGCTTGCTTTCTCGAGAAAGCAAGCCAAGCAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144568.1-551s1c1
Sequence:CCGGCAAAGTGACATCCCAACGGATCTCGAGATCCGTTGGGATGTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033271
VALIDATED
TMEM55B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 55B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033271.4-876s21c1
Sequence:CCGGGCCCTTTATTGGGCTTGTATGCTCGAGCATACAAGCCCAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033271.4-385s21c1
Sequence:CCGGTGCATCAGCATGTAGTCAAATCTCGAGATTTGACTACATGCTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033271.4-471s21c1
Sequence:CCGGCCCTGTAATTGTCTCCTTATCCTCGAGGATAAGGAGACAATTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033271.4-697s21c1
Sequence:CCGGCATCTATTGGGAGACGATATCCTCGAGGATATCGTCTCCCAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033271.4-2353s21c1
Sequence:CCGGCATGTTCTTCCTCGCCTATAACTCGAGTTATAGGCGAGGAAGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033271
VALIDATED
TMEM55B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 55B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033271.4-876s21c1
Sequence:CCGGGCCCTTTATTGGGCTTGTATGCTCGAGCATACAAGCCCAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033271.4-385s21c1
Sequence:CCGGTGCATCAGCATGTAGTCAAATCTCGAGATTTGACTACATGCTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033271.4-471s21c1
Sequence:CCGGCCCTGTAATTGTCTCCTTATCCTCGAGGATAAGGAGACAATTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033271.4-697s21c1
Sequence:CCGGCATCTATTGGGAGACGATATCCTCGAGGATATCGTCTCCCAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033271.4-2353s21c1
Sequence:CCGGCATGTTCTTCCTCGCCTATAACTCGAGTTATAGGCGAGGAAGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033271
VALIDATED
TMEM55B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 55B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033271.4-876s21c1
Sequence:CCGGGCCCTTTATTGGGCTTGTATGCTCGAGCATACAAGCCCAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033271.4-385s21c1
Sequence:CCGGTGCATCAGCATGTAGTCAAATCTCGAGATTTGACTACATGCTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033271.4-471s21c1
Sequence:CCGGCCCTGTAATTGTCTCCTTATCCTCGAGGATAAGGAGACAATTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033271.4-697s21c1
Sequence:CCGGCATCTATTGGGAGACGATATCCTCGAGGATATCGTCTCCCAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033271.4-2353s21c1
Sequence:CCGGCATGTTCTTCCTCGCCTATAACTCGAGTTATAGGCGAGGAAGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks