EMAIL THIS PAGE TO A FRIEND

TMEM56

transmembrane protein 56

UniProtKB ID: Q96MV1, B2RPI2, D3DT48
Gene ID:
Mouse(99887) transmembrane protein 56
Rat(365924) transmembrane protein 56
sheep(101108787) transmembrane protein 56
naked mole-rat(101698428) transmembrane protein 56
domestic guinea pig(100719834) transmembrane protein 56
chicken(424483) transmembrane protein 56
domestic cat(101080312) transmembrane protein 56
dog(490151) transmembrane protein 56-like
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178936 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178936 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178936 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152487 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152487 Rosetta Predictions human pricing
XM_001073749 Rosetta Predictions rat pricing
XM_345284 Rosetta Predictions rat pricing
NM_178936 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072441 predicted 229
2 SASI_Hs01_00072442 predicted 720
3 SASI_Hs01_00072443 predicted 813
4 SASI_Hs01_00072444 predicted 529
5 SASI_Hs01_00072445 predicted 355
6 SASI_Hs01_00072446 predicted 839
7 SASI_Hs01_00072447 predicted 407
8 SASI_Hs01_00072448 predicted 459
9 SASI_Hs01_00072449 predicted 576
10 SASI_Hs02_00366263 predicted 728
11 SASI_Hs01_00072440 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343762 predicted 295
2 SASI_Rn02_00343763 predicted 580
3 SASI_Rn02_00343764 predicted 625
4 SASI_Rn02_00343765 predicted 617
5 SASI_Rn02_00343766 predicted 366
6 SASI_Rn02_00343767 predicted 469
7 SASI_Rn02_00343768 predicted 589
8 SASI_Rn02_00343769 predicted 682
9 SASI_Rn02_00343770 predicted 575
10 SASI_Rn02_00343771 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398164 predicted 299
2 SASI_Rn02_00398165 predicted 578
3 SASI_Rn02_00398166 predicted 622
4 SASI_Rn02_00398167 predicted 612
5 SASI_Rn02_00398168 predicted 364
6 SASI_Rn02_00398169 predicted 465
7 SASI_Rn02_00398170 predicted 586
8 SASI_Rn02_00398171 predicted 689
9 SASI_Rn02_00398172 predicted 577
10 SASI_Rn02_00398173 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021712 predicted 901
2 SASI_Mm01_00021713 predicted 444
3 SASI_Mm01_00021714 predicted 794
4 SASI_Mm01_00021715 predicted 663
5 SASI_Mm01_00021716 predicted 544
6 SASI_Mm01_00021717 predicted 1162
7 SASI_Mm01_00021718 predicted 1157
8 SASI_Mm01_00021719 predicted 936
9 SASI_Mm01_00021720 predicted 990
10 SASI_Mm01_00021721 predicted 877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178936
TMEM56 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 56
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178936.2-2015s1c1
Sequence:CCGGGCTTAGTTTGTCTTTGCCTTTCTCGAGAAAGGCAAAGACAAACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178936.2-972s1c1
Sequence:CCGGGATGAATATCATGTGGATGATCTCGAGATCATCCACATGATATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178936.2-852s1c1
Sequence:CCGGGATCATTTCGATACCTCCGATCTCGAGATCGGAGGTATCGAAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178936.2-459s1c1
Sequence:CCGGCCACTCTTTGTTAGTTGGGATCTCGAGATCCCAACTAACAAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178936.2-2982s1c1
Sequence:CCGGCCAATAAGTATGTTCGGAATACTCGAGTATTCCGAACATACTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178936.3-618s21c1
Sequence:CCGGGAAAGTGATCGGCGACAAATTCTCGAGAATTTGTCGCCGATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178936.3-383s21c1
Sequence:CCGGCAAGAGTTTCTTCAGGTTATACTCGAGTATAACCTGAAGAAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178936
TMEM56 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 56
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178936.2-2015s1c1
Sequence:CCGGGCTTAGTTTGTCTTTGCCTTTCTCGAGAAAGGCAAAGACAAACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178936.2-972s1c1
Sequence:CCGGGATGAATATCATGTGGATGATCTCGAGATCATCCACATGATATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178936.2-852s1c1
Sequence:CCGGGATCATTTCGATACCTCCGATCTCGAGATCGGAGGTATCGAAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178936.2-459s1c1
Sequence:CCGGCCACTCTTTGTTAGTTGGGATCTCGAGATCCCAACTAACAAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178936.2-2982s1c1
Sequence:CCGGCCAATAAGTATGTTCGGAATACTCGAGTATTCCGAACATACTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178936.3-618s21c1
Sequence:CCGGGAAAGTGATCGGCGACAAATTCTCGAGAATTTGTCGCCGATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178936.3-383s21c1
Sequence:CCGGCAAGAGTTTCTTCAGGTTATACTCGAGTATAACCTGAAGAAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178936
TMEM56 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 56
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178936.2-2015s1c1
Sequence:CCGGGCTTAGTTTGTCTTTGCCTTTCTCGAGAAAGGCAAAGACAAACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178936.2-972s1c1
Sequence:CCGGGATGAATATCATGTGGATGATCTCGAGATCATCCACATGATATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178936.2-852s1c1
Sequence:CCGGGATCATTTCGATACCTCCGATCTCGAGATCGGAGGTATCGAAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178936.2-459s1c1
Sequence:CCGGCCACTCTTTGTTAGTTGGGATCTCGAGATCCCAACTAACAAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178936.2-2982s1c1
Sequence:CCGGCCAATAAGTATGTTCGGAATACTCGAGTATTCCGAACATACTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178936.3-618s21c1
Sequence:CCGGGAAAGTGATCGGCGACAAATTCTCGAGAATTTGTCGCCGATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178936.3-383s21c1
Sequence:CCGGCAAGAGTTTCTTCAGGTTATACTCGAGTATAACCTGAAGAAACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152487
VALIDATED
TMEM56 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 56
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-781s1c1
Sequence:CCGGCCTCATTATGGCTTCATGTATCTCGAGATACATGAAGCCATAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-2244s1c1
Sequence:CCGGCCTCTTCTTGATGAGACCCAACTCGAGTTGGGTCTCATCAAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152487.1-610s1c1
Sequence:CCGGGTGCTGGCATACATTGGGAATCTCGAGATTCCCAATGTATGCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-1231s1c1
Sequence:CCGGGCCAACATGGTGAAACCTCATCTCGAGATGAGGTTTCACCATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-371s1c1
Sequence:CCGGGCCATTCTTTGGTGGTTGGTACTCGAGTACCAACCACCAAAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-942s1c1
Sequence:CCGGCATCAGACAAGAGAAAGCCAACTCGAGTTGGCTTTCTCTTGTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-228s1c1
Sequence:CCGGCAGTGTTACCTGTATCAGCTTCTCGAGAAGCTGATACAGGTAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-748s1c1
Sequence:CCGGGTATTCTTCATCGTGCGGATTCTCGAGAATCCGCACGATGAAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-1995s1c1
Sequence:CCGGGACAGATTATAGACCTCCTTACTCGAGTAAGGAGGTCTATAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-885s1c1
Sequence:CCGGGATGAATGTCATGTGGATGATCTCGAGATCATCCACATGACATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152487.1-924s1c1
Sequence:CCGGCATCAAAGTCATCTCTCACATCTCGAGATGTGAGAGATGACTTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-583s1c1
Sequence:CCGGGCATACTACCTTGTACTGAAACTCGAGTTTCAGTACAAGGTAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152487
VALIDATED
TMEM56 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 56
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-781s1c1
Sequence:CCGGCCTCATTATGGCTTCATGTATCTCGAGATACATGAAGCCATAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-2244s1c1
Sequence:CCGGCCTCTTCTTGATGAGACCCAACTCGAGTTGGGTCTCATCAAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152487.1-610s1c1
Sequence:CCGGGTGCTGGCATACATTGGGAATCTCGAGATTCCCAATGTATGCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-1231s1c1
Sequence:CCGGGCCAACATGGTGAAACCTCATCTCGAGATGAGGTTTCACCATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-371s1c1
Sequence:CCGGGCCATTCTTTGGTGGTTGGTACTCGAGTACCAACCACCAAAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-942s1c1
Sequence:CCGGCATCAGACAAGAGAAAGCCAACTCGAGTTGGCTTTCTCTTGTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-228s1c1
Sequence:CCGGCAGTGTTACCTGTATCAGCTTCTCGAGAAGCTGATACAGGTAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-748s1c1
Sequence:CCGGGTATTCTTCATCGTGCGGATTCTCGAGAATCCGCACGATGAAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-1995s1c1
Sequence:CCGGGACAGATTATAGACCTCCTTACTCGAGTAAGGAGGTCTATAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-885s1c1
Sequence:CCGGGATGAATGTCATGTGGATGATCTCGAGATCATCCACATGACATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152487.1-924s1c1
Sequence:CCGGCATCAAAGTCATCTCTCACATCTCGAGATGTGAGAGATGACTTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-583s1c1
Sequence:CCGGGCATACTACCTTGTACTGAAACTCGAGTTTCAGTACAAGGTAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152487
VALIDATED
TMEM56 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 56
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-781s1c1
Sequence:CCGGCCTCATTATGGCTTCATGTATCTCGAGATACATGAAGCCATAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-2244s1c1
Sequence:CCGGCCTCTTCTTGATGAGACCCAACTCGAGTTGGGTCTCATCAAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152487.1-610s1c1
Sequence:CCGGGTGCTGGCATACATTGGGAATCTCGAGATTCCCAATGTATGCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-1231s1c1
Sequence:CCGGGCCAACATGGTGAAACCTCATCTCGAGATGAGGTTTCACCATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-371s1c1
Sequence:CCGGGCCATTCTTTGGTGGTTGGTACTCGAGTACCAACCACCAAAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-942s1c1
Sequence:CCGGCATCAGACAAGAGAAAGCCAACTCGAGTTGGCTTTCTCTTGTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-228s1c1
Sequence:CCGGCAGTGTTACCTGTATCAGCTTCTCGAGAAGCTGATACAGGTAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-748s1c1
Sequence:CCGGGTATTCTTCATCGTGCGGATTCTCGAGAATCCGCACGATGAAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-1995s1c1
Sequence:CCGGGACAGATTATAGACCTCCTTACTCGAGTAAGGAGGTCTATAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152487.1-885s1c1
Sequence:CCGGGATGAATGTCATGTGGATGATCTCGAGATCATCCACATGACATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152487.1-924s1c1
Sequence:CCGGCATCAAAGTCATCTCTCACATCTCGAGATGTGAGAGATGACTTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_152487.1-583s1c1
Sequence:CCGGGCATACTACCTTGTACTGAAACTCGAGTTTCAGTACAAGGTAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks