EMAIL THIS PAGE TO A FRIEND

TMEM57

transmembrane protein 57

Synonyms: MACOILIN
UniProtKB ID: Q8N5G2, B1AK00, Q2TLX5, Q2TLX6, Q9NVG6
Gene ID:
Mouse(66146) transmembrane protein 57
Rat(313618) transmembrane protein 57
chicken(419590) transmembrane protein 57
domestic cat(101099227) transmembrane protein 57
dog(478180) transmembrane protein 57
domestic guinea pig(100734166) transmembrane protein 57
naked mole-rat(101697985) transmembrane protein 57
Domestic Rabbit(100354622) transmembrane protein 57
cow(540726) transmembrane protein 57
sheep(101118595) transmembrane protein 57
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018202 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU077251 MISSION® esiRNA esiRNA targeting mouse Tmem57 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018202 Rosetta Predictions human pricing
NM_001025699 Rosetta Predictions rat pricing
NM_025382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137071 predicted 1016
2 SASI_Hs01_00137072 predicted 1745
3 SASI_Hs01_00137073 predicted 915
4 SASI_Hs01_00137074 predicted 831
5 SASI_Hs02_00351489 predicted 1483
6 SASI_Hs01_00137075 predicted 1751
7 SASI_Hs01_00137076 predicted 1679
8 SASI_Hs02_00351490 predicted 1156
9 SASI_Hs01_00137077 predicted 1252
10 SASI_Hs01_00137079 predicted 992
11 SASI_Hs01_00137078 predicted 855
12 SASI_Hs01_00137080 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082247 predicted 1018
2 SASI_Rn01_00082248 predicted 1275
3 SASI_Rn01_00082249 predicted 1015
4 SASI_Rn01_00082250 predicted 1024
5 SASI_Rn02_00203319 predicted 1399
6 SASI_Rn01_00082251 predicted 1264
7 SASI_Rn01_00082252 predicted 967
8 SASI_Rn01_00082253 predicted 1018
9 SASI_Rn01_00082254 predicted 920
10 SASI_Rn01_00082255 predicted 1682
11 SASI_Rn01_00082256 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107831 predicted 1069
2 SASI_Mm02_00328112 predicted 1065
3 SASI_Mm01_00107833 predicted 1315
4 SASI_Mm01_00107834 predicted 551
5 SASI_Mm01_00107835 predicted 420
6 SASI_Mm02_00328113 predicted 466
7 SASI_Mm02_00328114 predicted 1604
8 SASI_Mm01_00107836 predicted 633
9 SASI_Mm01_00107837 predicted 1026
10 SASI_Mm01_00107839 predicted 462
11 SASI_Mm01_00107832 predicted 865
12 SASI_Mm01_00107838 predicted 1579
13 SASI_Mm01_00107840 predicted 1237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025382
VALIDATED
TMEM57 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 57
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025382.6-2659s21c1
Sequence:CCGGTGATTCCATAGCTGCATTAAACTCGAGTTTAATGCAGCTATGGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025382.6-295s21c1
Sequence:CCGGGGTATCTACGGCAGTACATTTCTCGAGAAATGTACTGCCGTAGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025382.6-2355s21c1
Sequence:CCGGATAACATCCAAGTCTGATTAGCTCGAGCTAATCAGACTTGGATGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025382.6-347s21c1
Sequence:CCGGTTGTCCTCCTTGCCGACTTTGCTCGAGCAAAGTCGGCAAGGAGGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025382.6-1073s21c1
Sequence:CCGGAGATACAAGAGATTGAGTATACTCGAGTATACTCAATCTCTTGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025382.3-1375s1c1
Sequence:CCGGCCAGCTAGAGAAGAAGCTAAACTCGAGTTTAGCTTCTTCTCTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025382.3-755s1c1
Sequence:CCGGCCAGAGATAGAATATCGAGAACTCGAGTTCTCGATATTCTATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025382.3-205s1c1
Sequence:CCGGCGTCTATGATTCCTTCAGATACTCGAGTATCTGAAGGAATCATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025382.3-1825s1c1
Sequence:CCGGCCAGGAAATCAAGGACCTAAACTCGAGTTTAGGTCCTTGATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025382.3-2872s1c1
Sequence:CCGGCGTGCCATTTACTGCTTTCTTCTCGAGAAGAAAGCAGTAAATGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025382
VALIDATED
TMEM57 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 57
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025382.6-2659s21c1
Sequence:CCGGTGATTCCATAGCTGCATTAAACTCGAGTTTAATGCAGCTATGGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025382.6-295s21c1
Sequence:CCGGGGTATCTACGGCAGTACATTTCTCGAGAAATGTACTGCCGTAGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025382.6-2355s21c1
Sequence:CCGGATAACATCCAAGTCTGATTAGCTCGAGCTAATCAGACTTGGATGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025382.6-347s21c1
Sequence:CCGGTTGTCCTCCTTGCCGACTTTGCTCGAGCAAAGTCGGCAAGGAGGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025382.6-1073s21c1
Sequence:CCGGAGATACAAGAGATTGAGTATACTCGAGTATACTCAATCTCTTGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025382.3-1375s1c1
Sequence:CCGGCCAGCTAGAGAAGAAGCTAAACTCGAGTTTAGCTTCTTCTCTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025382.3-755s1c1
Sequence:CCGGCCAGAGATAGAATATCGAGAACTCGAGTTCTCGATATTCTATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025382.3-205s1c1
Sequence:CCGGCGTCTATGATTCCTTCAGATACTCGAGTATCTGAAGGAATCATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025382.3-1825s1c1
Sequence:CCGGCCAGGAAATCAAGGACCTAAACTCGAGTTTAGGTCCTTGATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025382.3-2872s1c1
Sequence:CCGGCGTGCCATTTACTGCTTTCTTCTCGAGAAGAAAGCAGTAAATGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025382
VALIDATED
TMEM57 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 57
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025382.6-2659s21c1
Sequence:CCGGTGATTCCATAGCTGCATTAAACTCGAGTTTAATGCAGCTATGGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025382.6-295s21c1
Sequence:CCGGGGTATCTACGGCAGTACATTTCTCGAGAAATGTACTGCCGTAGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025382.6-2355s21c1
Sequence:CCGGATAACATCCAAGTCTGATTAGCTCGAGCTAATCAGACTTGGATGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025382.6-347s21c1
Sequence:CCGGTTGTCCTCCTTGCCGACTTTGCTCGAGCAAAGTCGGCAAGGAGGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025382.6-1073s21c1
Sequence:CCGGAGATACAAGAGATTGAGTATACTCGAGTATACTCAATCTCTTGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025382.3-1375s1c1
Sequence:CCGGCCAGCTAGAGAAGAAGCTAAACTCGAGTTTAGCTTCTTCTCTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025382.3-755s1c1
Sequence:CCGGCCAGAGATAGAATATCGAGAACTCGAGTTCTCGATATTCTATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025382.3-205s1c1
Sequence:CCGGCGTCTATGATTCCTTCAGATACTCGAGTATCTGAAGGAATCATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025382.3-1825s1c1
Sequence:CCGGCCAGGAAATCAAGGACCTAAACTCGAGTTTAGGTCCTTGATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025382.3-2872s1c1
Sequence:CCGGCGTGCCATTTACTGCTTTCTTCTCGAGAAGAAAGCAGTAAATGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018202
VALIDATED
TMEM57 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 57
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018202.4-447s21c1
Sequence:CCGGGTGTAGCATTCACGTCAAATACTCGAGTATTTGACGTGAATGCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018202.4-854s21c1
Sequence:CCGGGCAGCCAAAGGATTACCTGATCTCGAGATCAGGTAATCCTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018202.4-2339s21c1
Sequence:CCGGGATAACATCCAAGTCTGATTACTCGAGTAATCAGACTTGGATGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018202.4-1721s21c1
Sequence:CCGGCGGAATCGGATCAGAGAACTACTCGAGTAGTTCTCTGATCCGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018202.2-779s1c1
Sequence:CCGGGATATGGATTCTTCGATCCTTCTCGAGAAGGATCGAAGAATCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018202.2-1459s1c1
Sequence:CCGGGCAGAATATCAGCCAGTTGGACTCGAGTCCAACTGGCTGATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018202.2-761s1c1
Sequence:CCGGGCAGCCAAAGGATTACCTGATCTCGAGATCAGGTAATCCTTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018202.2-1628s1c1
Sequence:CCGGCGGAATCGGATCAGAGAACTACTCGAGTAGTTCTCTGATCCGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018202.2-1837s1c1
Sequence:CCGGGAGAATCAAGCTGGACCTGTTCTCGAGAACAGGTCCAGCTTGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018202.2-1109s1c1
Sequence:CCGGCGAAGTCATAGCGCCACAAATCTCGAGATTTGTGGCGCTATGACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018202.2-2208s1c1
Sequence:CCGGGAACTGTATCTGTTGTCATTTCTCGAGAAATGACAACAGATACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018202.2-1681s1c1
Sequence:CCGGGAAGGTGAAAGAAGACCAAATCTCGAGATTTGGTCTTCTTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018202.2-2246s1c1
Sequence:CCGGGATAACATCCAAGTCTGATTACTCGAGTAATCAGACTTGGATGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018202
VALIDATED
TMEM57 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 57
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018202.4-447s21c1
Sequence:CCGGGTGTAGCATTCACGTCAAATACTCGAGTATTTGACGTGAATGCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018202.4-854s21c1
Sequence:CCGGGCAGCCAAAGGATTACCTGATCTCGAGATCAGGTAATCCTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018202.4-2339s21c1
Sequence:CCGGGATAACATCCAAGTCTGATTACTCGAGTAATCAGACTTGGATGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018202.4-1721s21c1
Sequence:CCGGCGGAATCGGATCAGAGAACTACTCGAGTAGTTCTCTGATCCGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018202.2-779s1c1
Sequence:CCGGGATATGGATTCTTCGATCCTTCTCGAGAAGGATCGAAGAATCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018202.2-1459s1c1
Sequence:CCGGGCAGAATATCAGCCAGTTGGACTCGAGTCCAACTGGCTGATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018202.2-761s1c1
Sequence:CCGGGCAGCCAAAGGATTACCTGATCTCGAGATCAGGTAATCCTTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018202.2-1628s1c1
Sequence:CCGGCGGAATCGGATCAGAGAACTACTCGAGTAGTTCTCTGATCCGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018202.2-1837s1c1
Sequence:CCGGGAGAATCAAGCTGGACCTGTTCTCGAGAACAGGTCCAGCTTGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018202.2-1109s1c1
Sequence:CCGGCGAAGTCATAGCGCCACAAATCTCGAGATTTGTGGCGCTATGACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018202.2-2208s1c1
Sequence:CCGGGAACTGTATCTGTTGTCATTTCTCGAGAAATGACAACAGATACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018202.2-1681s1c1
Sequence:CCGGGAAGGTGAAAGAAGACCAAATCTCGAGATTTGGTCTTCTTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018202.2-2246s1c1
Sequence:CCGGGATAACATCCAAGTCTGATTACTCGAGTAATCAGACTTGGATGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018202
VALIDATED
TMEM57 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 57
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018202.4-447s21c1
Sequence:CCGGGTGTAGCATTCACGTCAAATACTCGAGTATTTGACGTGAATGCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018202.4-854s21c1
Sequence:CCGGGCAGCCAAAGGATTACCTGATCTCGAGATCAGGTAATCCTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018202.4-2339s21c1
Sequence:CCGGGATAACATCCAAGTCTGATTACTCGAGTAATCAGACTTGGATGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018202.4-1721s21c1
Sequence:CCGGCGGAATCGGATCAGAGAACTACTCGAGTAGTTCTCTGATCCGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018202.2-779s1c1
Sequence:CCGGGATATGGATTCTTCGATCCTTCTCGAGAAGGATCGAAGAATCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018202.2-1459s1c1
Sequence:CCGGGCAGAATATCAGCCAGTTGGACTCGAGTCCAACTGGCTGATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018202.2-761s1c1
Sequence:CCGGGCAGCCAAAGGATTACCTGATCTCGAGATCAGGTAATCCTTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018202.2-1628s1c1
Sequence:CCGGCGGAATCGGATCAGAGAACTACTCGAGTAGTTCTCTGATCCGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018202.2-1837s1c1
Sequence:CCGGGAGAATCAAGCTGGACCTGTTCTCGAGAACAGGTCCAGCTTGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018202.2-1109s1c1
Sequence:CCGGCGAAGTCATAGCGCCACAAATCTCGAGATTTGTGGCGCTATGACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018202.2-2208s1c1
Sequence:CCGGGAACTGTATCTGTTGTCATTTCTCGAGAAATGACAACAGATACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018202.2-1681s1c1
Sequence:CCGGGAAGGTGAAAGAAGACCAAATCTCGAGATTTGGTCTTCTTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018202.2-2246s1c1
Sequence:CCGGGATAACATCCAAGTCTGATTACTCGAGTAATCAGACTTGGATGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks