EMAIL THIS PAGE TO A FRIEND

TMEM59

transmembrane protein 59

Synonyms: C1orf8 HSPC001
UniProtKB ID: Q9BXS4, B3KQL7, O75393, Q4VBP9, Q5T705, Q96KX7
Gene ID:
Mouse(56374) transmembrane protein 59
Zebrafish(566384) transmembrane protein 59
dog(479561) transmembrane protein 59
domestic cat(101096251) transmembrane protein 59
chicken(424656) transmembrane protein 59
cow(509775) transmembrane protein 59
sheep(101121128) transmembrane protein 59
naked mole-rat(101702343) transmembrane protein 59
domestic guinea pig(100714824) transmembrane protein 59
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004872 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032441 MISSION® esiRNA esiRNA human TMEM59 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004872 Rosetta Predictions human pricing
NM_029565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213323 predicted 1111
2 SASI_Hs02_00338501 predicted 436
3 SASI_Hs01_00213324 predicted 521
4 SASI_Hs01_00213325 predicted 501
5 SASI_Hs01_00213327 predicted 1073
6 SASI_Hs01_00213328 predicted 844
7 SASI_Hs01_00213329 predicted 974
8 SASI_Hs02_00338502 predicted 1008
9 SASI_Hs02_00338503 predicted 487
10 SASI_Hs01_00213331 predicted 814
11 SASI_Hs01_00213326 predicted 1060
12 SASI_Hs01_00213330 predicted 637
13 SASI_Hs01_00213332 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174839 predicted 851
2 SASI_Mm01_00174840 predicted 846
3 SASI_Mm01_00174841 predicted 657
4 SASI_Mm01_00174842 predicted 898
5 SASI_Mm01_00174846 predicted 631
6 SASI_Mm01_00174847 predicted 278
7 SASI_Mm01_00174848 predicted 1023
8 SASI_Mm02_00335514 predicted 361
9 SASI_Mm02_00335515 predicted 1076
10 SASI_Mm02_00335516 predicted 918
11 SASI_Mm01_00174843 predicted 705
12 SASI_Mm01_00174844 predicted 990
13 SASI_Mm01_00174845 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004872
VALIDATED
TMEM59 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 59
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004872.3-1550s1c1
Sequence:CCGGCCTTAGTTAACAAGCTGAATACTCGAGTATTCAGCTTGTTAACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004872.3-1069s1c1
Sequence:CCGGGCTGAGTATCTATGGTGACTTCTCGAGAAGTCACCATAGATACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004872.3-723s1c1
Sequence:CCGGCACAGAGCTTCATAACCTCTTCTCGAGAAGAGGTTATGAAGCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004872.3-433s1c1
Sequence:CCGGCCCTAAGGAAGAGGAGTTGTACTCGAGTACAACTCCTCTTCCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004872.3-992s1c1
Sequence:CCGGCTCTCGGTGATGGTATTGCTTCTCGAGAAGCAATACCATCACCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004872.3-1048s1c1
Sequence:CCGGGCAGTATGTTCCCTCTGAGAACTCGAGTTCTCAGAGGGAACATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004872.3-803s1c1
Sequence:CCGGGAAATCCAGTACGCACCACATCTCGAGATGTGGTGCGTACTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004872.3-1344s1c1
Sequence:CCGGCTCAAATCTGTGAAGACTGTACTCGAGTACAGTCTTCACAGATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004872.3-1128s1c1
Sequence:CCGGCTTCTTCTCTTGTGGTTGTTACTCGAGTAACAACCACAAGAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004872
VALIDATED
TMEM59 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 59
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004872.3-1550s1c1
Sequence:CCGGCCTTAGTTAACAAGCTGAATACTCGAGTATTCAGCTTGTTAACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004872.3-1069s1c1
Sequence:CCGGGCTGAGTATCTATGGTGACTTCTCGAGAAGTCACCATAGATACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004872.3-723s1c1
Sequence:CCGGCACAGAGCTTCATAACCTCTTCTCGAGAAGAGGTTATGAAGCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004872.3-433s1c1
Sequence:CCGGCCCTAAGGAAGAGGAGTTGTACTCGAGTACAACTCCTCTTCCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004872.3-992s1c1
Sequence:CCGGCTCTCGGTGATGGTATTGCTTCTCGAGAAGCAATACCATCACCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004872.3-1048s1c1
Sequence:CCGGGCAGTATGTTCCCTCTGAGAACTCGAGTTCTCAGAGGGAACATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004872.3-803s1c1
Sequence:CCGGGAAATCCAGTACGCACCACATCTCGAGATGTGGTGCGTACTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004872.3-1344s1c1
Sequence:CCGGCTCAAATCTGTGAAGACTGTACTCGAGTACAGTCTTCACAGATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004872.3-1128s1c1
Sequence:CCGGCTTCTTCTCTTGTGGTTGTTACTCGAGTAACAACCACAAGAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004872
VALIDATED
TMEM59 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 59
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004872.3-1550s1c1
Sequence:CCGGCCTTAGTTAACAAGCTGAATACTCGAGTATTCAGCTTGTTAACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004872.3-1069s1c1
Sequence:CCGGGCTGAGTATCTATGGTGACTTCTCGAGAAGTCACCATAGATACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004872.3-723s1c1
Sequence:CCGGCACAGAGCTTCATAACCTCTTCTCGAGAAGAGGTTATGAAGCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004872.3-433s1c1
Sequence:CCGGCCCTAAGGAAGAGGAGTTGTACTCGAGTACAACTCCTCTTCCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004872.3-992s1c1
Sequence:CCGGCTCTCGGTGATGGTATTGCTTCTCGAGAAGCAATACCATCACCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004872.3-1048s1c1
Sequence:CCGGGCAGTATGTTCCCTCTGAGAACTCGAGTTCTCAGAGGGAACATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004872.3-803s1c1
Sequence:CCGGGAAATCCAGTACGCACCACATCTCGAGATGTGGTGCGTACTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004872.3-1344s1c1
Sequence:CCGGCTCAAATCTGTGAAGACTGTACTCGAGTACAGTCTTCACAGATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004872.3-1128s1c1
Sequence:CCGGCTTCTTCTCTTGTGGTTGTTACTCGAGTAACAACCACAAGAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029565
TMEM59 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 59
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029565.2-686s1c1
Sequence:CCGGGCACACAGGAACTACCTTGAACTCGAGTTCAAGGTAGTTCCTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029565.2-620s1c1
Sequence:CCGGGAGCCTACAAACTTGAGAGAACTCGAGTTCTCTCAAGTTTGTAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029565.2-848s1c1
Sequence:CCGGCCTGAGAAGCTGAGTATCTATCTCGAGATAGATACTCAGCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029565.2-295s1c1
Sequence:CCGGGCTTGATTTAAATCGGACCAACTCGAGTTGGTCCGATTTAAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029565.2-1264s1c1
Sequence:CCGGCGCCAAATTCTATGAGCTGATCTCGAGATCAGCTCATAGAATTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029565
TMEM59 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 59
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029565.2-686s1c1
Sequence:CCGGGCACACAGGAACTACCTTGAACTCGAGTTCAAGGTAGTTCCTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029565.2-620s1c1
Sequence:CCGGGAGCCTACAAACTTGAGAGAACTCGAGTTCTCTCAAGTTTGTAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029565.2-848s1c1
Sequence:CCGGCCTGAGAAGCTGAGTATCTATCTCGAGATAGATACTCAGCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029565.2-295s1c1
Sequence:CCGGGCTTGATTTAAATCGGACCAACTCGAGTTGGTCCGATTTAAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029565.2-1264s1c1
Sequence:CCGGCGCCAAATTCTATGAGCTGATCTCGAGATCAGCTCATAGAATTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029565
TMEM59 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 59
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029565.2-686s1c1
Sequence:CCGGGCACACAGGAACTACCTTGAACTCGAGTTCAAGGTAGTTCCTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029565.2-620s1c1
Sequence:CCGGGAGCCTACAAACTTGAGAGAACTCGAGTTCTCTCAAGTTTGTAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029565.2-848s1c1
Sequence:CCGGCCTGAGAAGCTGAGTATCTATCTCGAGATAGATACTCAGCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029565.2-295s1c1
Sequence:CCGGGCTTGATTTAAATCGGACCAACTCGAGTTGGTCCGATTTAAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029565.2-1264s1c1
Sequence:CCGGCGCCAAATTCTATGAGCTGATCTCGAGATCAGCTCATAGAATTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks