EMAIL THIS PAGE TO A FRIEND

TMEM59L

transmembrane protein 59-like

Synonyms: BSMAP C19orf4
UniProtKB ID: Q9UK28
Gene ID:
Human(25789) Summary: This gene encodes a predicted type-I membrane glycoprotein. The encoded protein may play a role in functioning of the central nervous system. [provided by RefSeq, Jul 2008]
Mouse(67937) transmembrane protein 59-like
Rat(306349) transmembrane protein 59-like
domestic guinea pig(100735998) transmembrane protein 59-like
naked mole-rat(101701520) transmembrane protein 59-like
cow(507157) transmembrane protein 59-like
sheep(101108652) transmembrane protein 59-like
Zebrafish(406646) transmembrane protein 59-like
dog(609259) transmembrane protein 59-like
chicken(420122) transmembrane protein 59-like
domestic cat(101088310) transmembrane protein 59-like
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012109 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182991 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182991 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182991 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012109 Rosetta Predictions human pricing
XM_001067996 Rosetta Predictions rat pricing
XM_224729 Rosetta Predictions rat pricing
NM_182991 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106558 predicted 376
2 SASI_Hs01_00106559 predicted 1066
3 SASI_Hs02_00343636 predicted 633
4 SASI_Hs01_00106560 predicted 598
5 SASI_Hs01_00106561 predicted 835
6 SASI_Hs01_00106562 predicted 372
7 SASI_Hs01_00106563 predicted 1100
8 SASI_Hs01_00106564 predicted 613
9 SASI_Hs01_00106565 predicted 557
10 SASI_Hs01_00106567 predicted 783
11 SASI_Hs01_00106566 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323046 predicted 504
2 SASI_Rn02_00323047 predicted 546
3 SASI_Rn02_00323048 predicted 779
4 SASI_Rn02_00323049 predicted 546
5 SASI_Rn02_00323050 predicted 1239
6 SASI_Rn02_00323051 predicted 1149
7 SASI_Rn02_00323052 predicted 1012
8 SASI_Rn02_00323053 predicted 916
9 SASI_Rn02_00323054 predicted 832
10 SASI_Rn02_00323055 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224729 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382214 predicted 505
2 SASI_Rn02_00382215 predicted 541
3 SASI_Rn02_00382216 predicted 841
4 SASI_Rn02_00382217 predicted 772
5 SASI_Rn02_00382218 predicted 540
6 SASI_Rn02_00382219 predicted 1148
7 SASI_Rn02_00382220 predicted 627
8 SASI_Rn02_00382221 predicted 1016
9 SASI_Rn02_00382222 predicted 914
10 SASI_Rn02_00382223 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147632 predicted 218
2 SASI_Mm01_00147633 predicted 566
3 SASI_Mm01_00147634 predicted 1006
4 SASI_Mm02_00349999 predicted 362
5 SASI_Mm01_00147635 predicted 223
6 SASI_Mm01_00147636 predicted 853
7 SASI_Mm01_00147637 predicted 823
8 SASI_Mm02_00350000 predicted 1267
9 SASI_Mm01_00147639 predicted 954
10 SASI_Mm02_00350001 predicted 1033
11 SASI_Mm01_00147638 predicted 543
12 SASI_Mm01_00147640 predicted 950
13 SASI_Mm01_00147641 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012109
TMEM59L MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 59-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-569s1c1
Sequence:CCGGCCTGGACATACTACTTGCAGACTCGAGTCTGCAAGTAGTATGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-610s1c1
Sequence:CCGGGTGTTTCAGACTCAGCCCATACTCGAGTATGGGCTGAGTCTGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-813s1c1
Sequence:CCGGCAATGACTTCCTCAGTTGCATCTCGAGATGCAACTGAGGAAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-582s1c1
Sequence:CCGGCTTGCAGACTGACAATGGGAACTCGAGTTCCCATTGTCAGTCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-585s1c1
Sequence:CCGGGCAGACTGACAATGGGAAAGTCTCGAGACTTTCCCATTGTCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012109.2-1014s21c1
Sequence:CCGGCTTCATGATGGAGCCCGATTGCTCGAGCAATCGGGCTCCATCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012109.2-335s21c1
Sequence:CCGGTCTTCTCCATCTGCCGATTTGCTCGAGCAAATCGGCAGATGGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012109.2-557s21c1
Sequence:CCGGGCAATGACCTTGTCAACTCAGCTCGAGCTGAGTTGACAAGGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012109.2-379s21c1
Sequence:CCGGGCCACCCAAACTGAGTGTGAACTCGAGTTCACACTCAGTTTGGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012109
TMEM59L MISSION shRNA shRNA Plasmid DNA
transmembrane protein 59-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-569s1c1
Sequence:CCGGCCTGGACATACTACTTGCAGACTCGAGTCTGCAAGTAGTATGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-610s1c1
Sequence:CCGGGTGTTTCAGACTCAGCCCATACTCGAGTATGGGCTGAGTCTGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-813s1c1
Sequence:CCGGCAATGACTTCCTCAGTTGCATCTCGAGATGCAACTGAGGAAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-582s1c1
Sequence:CCGGCTTGCAGACTGACAATGGGAACTCGAGTTCCCATTGTCAGTCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-585s1c1
Sequence:CCGGGCAGACTGACAATGGGAAAGTCTCGAGACTTTCCCATTGTCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012109.2-1014s21c1
Sequence:CCGGCTTCATGATGGAGCCCGATTGCTCGAGCAATCGGGCTCCATCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012109.2-335s21c1
Sequence:CCGGTCTTCTCCATCTGCCGATTTGCTCGAGCAAATCGGCAGATGGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012109.2-557s21c1
Sequence:CCGGGCAATGACCTTGTCAACTCAGCTCGAGCTGAGTTGACAAGGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012109.2-379s21c1
Sequence:CCGGGCCACCCAAACTGAGTGTGAACTCGAGTTCACACTCAGTTTGGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012109
TMEM59L MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 59-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-569s1c1
Sequence:CCGGCCTGGACATACTACTTGCAGACTCGAGTCTGCAAGTAGTATGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-610s1c1
Sequence:CCGGGTGTTTCAGACTCAGCCCATACTCGAGTATGGGCTGAGTCTGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-813s1c1
Sequence:CCGGCAATGACTTCCTCAGTTGCATCTCGAGATGCAACTGAGGAAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-582s1c1
Sequence:CCGGCTTGCAGACTGACAATGGGAACTCGAGTTCCCATTGTCAGTCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012109.1-585s1c1
Sequence:CCGGGCAGACTGACAATGGGAAAGTCTCGAGACTTTCCCATTGTCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012109.2-1014s21c1
Sequence:CCGGCTTCATGATGGAGCCCGATTGCTCGAGCAATCGGGCTCCATCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012109.2-335s21c1
Sequence:CCGGTCTTCTCCATCTGCCGATTTGCTCGAGCAAATCGGCAGATGGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012109.2-557s21c1
Sequence:CCGGGCAATGACCTTGTCAACTCAGCTCGAGCTGAGTTGACAAGGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012109.2-379s21c1
Sequence:CCGGGCCACCCAAACTGAGTGTGAACTCGAGTTCACACTCAGTTTGGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182991
VALIDATED
TMEM59L MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 59-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182991.1-552s1c1
Sequence:CCGGCTTCAGACAGACAACCGGAAACTCGAGTTTCCGGTTGTCTGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182991.1-218s1c1
Sequence:CCGGCCCGAATAACAAGGCTATCCTCTCGAGAGGATAGCCTTGTTATTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182991.1-1271s1c1
Sequence:CCGGGCTTATTGACATTCCTCACATCTCGAGATGTGAGGAATGTCAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182991.1-1020s1c1
Sequence:CCGGCCTTACAAGTTGAAGCTTGATCTCGAGATCAAGCTTCAACTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182991.1-1034s1c1
Sequence:CCGGGCTTGATTTGACCACGCTGTACTCGAGTACAGCGTGGTCAAATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182991.2-1271s21c1
Sequence:CCGGGCTTATTGACATTCCTCACATCTCGAGATGTGAGGAATGTCAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182991.2-552s21c1
Sequence:CCGGCTTCAGACAGACAACCGGAAACTCGAGTTTCCGGTTGTCTGTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182991.2-218s21c1
Sequence:CCGGCCCGAATAACAAGGCTATCCTCTCGAGAGGATAGCCTTGTTATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182991.2-1020s21c1
Sequence:CCGGCCTTACAAGTTGAAGCTTGATCTCGAGATCAAGCTTCAACTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182991
VALIDATED
TMEM59L MISSION shRNA shRNA Plasmid DNA
transmembrane protein 59-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182991.1-552s1c1
Sequence:CCGGCTTCAGACAGACAACCGGAAACTCGAGTTTCCGGTTGTCTGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182991.1-218s1c1
Sequence:CCGGCCCGAATAACAAGGCTATCCTCTCGAGAGGATAGCCTTGTTATTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182991.1-1271s1c1
Sequence:CCGGGCTTATTGACATTCCTCACATCTCGAGATGTGAGGAATGTCAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182991.1-1020s1c1
Sequence:CCGGCCTTACAAGTTGAAGCTTGATCTCGAGATCAAGCTTCAACTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182991.1-1034s1c1
Sequence:CCGGGCTTGATTTGACCACGCTGTACTCGAGTACAGCGTGGTCAAATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182991.2-1271s21c1
Sequence:CCGGGCTTATTGACATTCCTCACATCTCGAGATGTGAGGAATGTCAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182991.2-552s21c1
Sequence:CCGGCTTCAGACAGACAACCGGAAACTCGAGTTTCCGGTTGTCTGTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182991.2-218s21c1
Sequence:CCGGCCCGAATAACAAGGCTATCCTCTCGAGAGGATAGCCTTGTTATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182991.2-1020s21c1
Sequence:CCGGCCTTACAAGTTGAAGCTTGATCTCGAGATCAAGCTTCAACTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182991
VALIDATED
TMEM59L MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 59-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182991.1-552s1c1
Sequence:CCGGCTTCAGACAGACAACCGGAAACTCGAGTTTCCGGTTGTCTGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182991.1-218s1c1
Sequence:CCGGCCCGAATAACAAGGCTATCCTCTCGAGAGGATAGCCTTGTTATTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182991.1-1271s1c1
Sequence:CCGGGCTTATTGACATTCCTCACATCTCGAGATGTGAGGAATGTCAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182991.1-1020s1c1
Sequence:CCGGCCTTACAAGTTGAAGCTTGATCTCGAGATCAAGCTTCAACTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182991.1-1034s1c1
Sequence:CCGGGCTTGATTTGACCACGCTGTACTCGAGTACAGCGTGGTCAAATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182991.2-1271s21c1
Sequence:CCGGGCTTATTGACATTCCTCACATCTCGAGATGTGAGGAATGTCAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182991.2-552s21c1
Sequence:CCGGCTTCAGACAGACAACCGGAAACTCGAGTTTCCGGTTGTCTGTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182991.2-218s21c1
Sequence:CCGGCCCGAATAACAAGGCTATCCTCTCGAGAGGATAGCCTTGTTATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182991.2-1020s21c1
Sequence:CCGGCCTTACAAGTTGAAGCTTGATCTCGAGATCAAGCTTCAACTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks