EMAIL THIS PAGE TO A FRIEND

TMEM5

transmembrane protein 5

Synonyms: HP10481 MDDGA10
UniProtKB ID: Q9Y2B1, A8K017, Q6PKD6
Gene ID:
Human(10329) Summary: This gene encodes a type II transmembrane protein that is thought to have glycosyltransferase function. Mutations in this gene result in cobblestone lissencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
Mouse(216395) transmembrane protein 5
Rat(299841) transmembrane protein 5
Zebrafish(557187) transmembrane protein 5
chicken(417820) transmembrane protein 5
domestic cat(101101235) transmembrane protein 5
Horse(100056566) transmembrane protein 5
dog(608152) transmembrane protein 5
Domestic Rabbit(100345411) transmembrane protein 5
naked mole-rat(101716790) transmembrane protein 5
domestic guinea pig(100732505) transmembrane protein 5
cow(515147) transmembrane protein 5
sheep(101112124) transmembrane protein 5
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014254 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153059 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153059 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153059 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014254 Rosetta Predictions human pricing
NM_001024759 Rosetta Predictions rat pricing
NM_153059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345313 predicted 905
2 SASI_Hs01_00051408 predicted 792
3 SASI_Hs01_00051410 predicted 822
4 SASI_Hs01_00051411 predicted 889
5 SASI_Hs01_00051413 predicted 836
6 SASI_Hs01_00051414 predicted 1054
7 SASI_Hs01_00051415 predicted 526
8 SASI_Hs01_00051416 predicted 574
9 SASI_Hs01_00051417 predicted 697
10 SASI_Hs02_00345314 predicted 513
11 SASI_Hs01_00051409 predicted 986
12 SASI_Hs01_00051412 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072296 predicted 1068
2 SASI_Rn01_00072297 predicted 503
3 SASI_Rn01_00072299 predicted 1062
4 SASI_Rn01_00072300 predicted 638
5 SASI_Rn01_00072301 predicted 652
6 SASI_Rn01_00072302 predicted 582
7 SASI_Rn01_00072303 predicted 959
8 SASI_Rn01_00072304 predicted 795
9 SASI_Rn01_00072305 predicted 1178
10 SASI_Rn02_00202638 predicted 1228
11 SASI_Rn01_00072298 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065058 predicted 730
2 SASI_Mm02_00342873 predicted 566
3 SASI_Mm01_00065060 predicted 753
4 SASI_Mm01_00065061 predicted 660
5 SASI_Mm01_00065062 predicted 506
6 SASI_Mm01_00065063 predicted 472
7 SASI_Mm01_00065064 predicted 432
8 SASI_Mm01_00065065 predicted 485
9 SASI_Mm02_00342874 predicted 391
10 SASI_Mm01_00065066 predicted 980
11 SASI_Mm01_00065059 predicted 980
12 SASI_Mm01_00065067 predicted 821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014254
VALIDATED
TMEM5 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-731s21c1
Sequence:CCGGGTGGATAAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-502s21c1
Sequence:CCGGGAAAGTCAATCGTAGGAAGAACTCGAGTTCTTCCTACGATTGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-633s21c1
Sequence:CCGGGCCACCCAGTGGTTACTTTATCTCGAGATAAAGTAACCACTGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-1243s21c1
Sequence:CCGGGTGCTCCCTTTATCTTTATCACTCGAGTGATAAAGATAAAGGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-270s21c1
Sequence:CCGGCGAGAACAGTCCACTTTGGAACTCGAGTTCCAAAGTGGACTGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014254.1-633s1c1
Sequence:CCGGGCCACCCAGTGGTTACTTTATCTCGAGATAAAGTAACCACTGGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014254.1-270s1c1
Sequence:CCGGCGAGAACAGTCCACTTTGGAACTCGAGTTCCAAAGTGGACTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014254.1-1070s1c1
Sequence:CCGGGCTTCAGAGTGATCTCACATTCTCGAGAATGTGAGATCACTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014254.1-731s1c1
Sequence:CCGGGTGGATAAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014254.1-502s1c1
Sequence:CCGGGAAAGTCAATCGTAGGAAGAACTCGAGTTCTTCCTACGATTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014254.1-1243s1c1
Sequence:CCGGGTGCTCCCTTTATCTTTATCACTCGAGTGATAAAGATAAAGGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014254.1-566s1c1
Sequence:CCGGCTTCTCCGTTGATGTGAATAACTCGAGTTATTCACATCAACGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014254
VALIDATED
TMEM5 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-731s21c1
Sequence:CCGGGTGGATAAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-502s21c1
Sequence:CCGGGAAAGTCAATCGTAGGAAGAACTCGAGTTCTTCCTACGATTGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-633s21c1
Sequence:CCGGGCCACCCAGTGGTTACTTTATCTCGAGATAAAGTAACCACTGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-1243s21c1
Sequence:CCGGGTGCTCCCTTTATCTTTATCACTCGAGTGATAAAGATAAAGGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-270s21c1
Sequence:CCGGCGAGAACAGTCCACTTTGGAACTCGAGTTCCAAAGTGGACTGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014254.1-633s1c1
Sequence:CCGGGCCACCCAGTGGTTACTTTATCTCGAGATAAAGTAACCACTGGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014254.1-270s1c1
Sequence:CCGGCGAGAACAGTCCACTTTGGAACTCGAGTTCCAAAGTGGACTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014254.1-1070s1c1
Sequence:CCGGGCTTCAGAGTGATCTCACATTCTCGAGAATGTGAGATCACTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014254.1-731s1c1
Sequence:CCGGGTGGATAAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014254.1-502s1c1
Sequence:CCGGGAAAGTCAATCGTAGGAAGAACTCGAGTTCTTCCTACGATTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014254.1-1243s1c1
Sequence:CCGGGTGCTCCCTTTATCTTTATCACTCGAGTGATAAAGATAAAGGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014254.1-566s1c1
Sequence:CCGGCTTCTCCGTTGATGTGAATAACTCGAGTTATTCACATCAACGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014254
VALIDATED
TMEM5 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-731s21c1
Sequence:CCGGGTGGATAAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-502s21c1
Sequence:CCGGGAAAGTCAATCGTAGGAAGAACTCGAGTTCTTCCTACGATTGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-633s21c1
Sequence:CCGGGCCACCCAGTGGTTACTTTATCTCGAGATAAAGTAACCACTGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-1243s21c1
Sequence:CCGGGTGCTCCCTTTATCTTTATCACTCGAGTGATAAAGATAAAGGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014254.1-270s21c1
Sequence:CCGGCGAGAACAGTCCACTTTGGAACTCGAGTTCCAAAGTGGACTGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014254.1-633s1c1
Sequence:CCGGGCCACCCAGTGGTTACTTTATCTCGAGATAAAGTAACCACTGGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014254.1-270s1c1
Sequence:CCGGCGAGAACAGTCCACTTTGGAACTCGAGTTCCAAAGTGGACTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014254.1-1070s1c1
Sequence:CCGGGCTTCAGAGTGATCTCACATTCTCGAGAATGTGAGATCACTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014254.1-731s1c1
Sequence:CCGGGTGGATAAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014254.1-502s1c1
Sequence:CCGGGAAAGTCAATCGTAGGAAGAACTCGAGTTCTTCCTACGATTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014254.1-1243s1c1
Sequence:CCGGGTGCTCCCTTTATCTTTATCACTCGAGTGATAAAGATAAAGGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014254.1-566s1c1
Sequence:CCGGCTTCTCCGTTGATGTGAATAACTCGAGTTATTCACATCAACGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153059
TMEM5 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-439s1c1
Sequence:CCGGAGTTGTAGGAAGAACGCATTACTCGAGTAATGCGTTCTTCCTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-879s1c1
Sequence:CCGGGACAAGCACTAATGAACATTTCTCGAGAAATGTTCATTAGTGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-265s1c1
Sequence:CCGGGCGACACAGAGTTAAGACCAACTCGAGTTGGTCTTAACTCTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-762s1c1
Sequence:CCGGCTTTAGGTGTAGCAACATATACTCGAGTATATGTTGCTACACCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-761s1c1
Sequence:CCGGCCTTTAGGTGTAGCAACATATCTCGAGATATGTTGCTACACCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153059
TMEM5 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-439s1c1
Sequence:CCGGAGTTGTAGGAAGAACGCATTACTCGAGTAATGCGTTCTTCCTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-879s1c1
Sequence:CCGGGACAAGCACTAATGAACATTTCTCGAGAAATGTTCATTAGTGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-265s1c1
Sequence:CCGGGCGACACAGAGTTAAGACCAACTCGAGTTGGTCTTAACTCTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-762s1c1
Sequence:CCGGCTTTAGGTGTAGCAACATATACTCGAGTATATGTTGCTACACCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-761s1c1
Sequence:CCGGCCTTTAGGTGTAGCAACATATCTCGAGATATGTTGCTACACCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153059
TMEM5 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-439s1c1
Sequence:CCGGAGTTGTAGGAAGAACGCATTACTCGAGTAATGCGTTCTTCCTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-879s1c1
Sequence:CCGGGACAAGCACTAATGAACATTTCTCGAGAAATGTTCATTAGTGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-265s1c1
Sequence:CCGGGCGACACAGAGTTAAGACCAACTCGAGTTGGTCTTAACTCTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-762s1c1
Sequence:CCGGCTTTAGGTGTAGCAACATATACTCGAGTATATGTTGCTACACCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153059.1-761s1c1
Sequence:CCGGCCTTTAGGTGTAGCAACATATCTCGAGATATGTTGCTACACCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks