EMAIL THIS PAGE TO A FRIEND

TMEM60

transmembrane protein 60

Synonyms: C7orf35
UniProtKB ID: Q9H2L4, A4D1C3, Q86UM0
Gene ID:
Mouse(212090) transmembrane protein 60
Rat(296761) transmembrane protein 60
chicken(417727) transmembrane protein 60
domestic cat(101089178) transmembrane protein 60
dog(100685779) transmembrane protein 60
cow(767911) transmembrane protein 60
sheep(101117242) transmembrane protein 60
naked mole-rat(101698687) transmembrane protein 60
domestic guinea pig(100729637) transmembrane protein 60
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032936 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032281 MISSION® esiRNA esiRNA human TMEM60 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032936 Rosetta Predictions human pricing
XM_001063081 Rosetta Predictions rat pricing
XM_216066 Rosetta Predictions rat pricing
NM_177601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080326 predicted 648
2 SASI_Hs01_00080327 predicted 825
3 SASI_Hs01_00080328 predicted 775
4 SASI_Hs01_00080330 predicted 580
5 SASI_Hs01_00080331 predicted 792
6 SASI_Hs01_00080332 predicted 417
7 SASI_Hs01_00080333 predicted 465
8 SASI_Hs01_00080334 predicted 632
9 SASI_Hs02_00360552 predicted 790
10 SASI_Hs02_00360553 predicted 271
11 SASI_Hs01_00080325 predicted 804
12 SASI_Hs01_00080329 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305718 predicted 91
2 SASI_Rn02_00305719 predicted 350
3 SASI_Rn02_00305720 predicted 311
4 SASI_Rn02_00305721 predicted 48
5 SASI_Rn02_00305722 predicted 223
6 SASI_Rn02_00305723 predicted 351
7 SASI_Rn02_00305724 predicted 138
8 SASI_Rn02_00305725 predicted 132
9 SASI_Rn02_00305726 predicted 142
10 SASI_Rn02_00305727 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376408 predicted 90
2 SASI_Rn02_00376409 predicted 348
3 SASI_Rn02_00376410 predicted 313
4 SASI_Rn02_00376411 predicted 42
5 SASI_Rn02_00376412 predicted 228
6 SASI_Rn02_00376413 predicted 358
7 SASI_Rn02_00376414 predicted 138
8 SASI_Rn02_00376415 predicted 131
9 SASI_Rn02_00376416 predicted 136
10 SASI_Rn02_00376417 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138933 predicted 340
2 SASI_Mm01_00138934 predicted 533
3 SASI_Mm01_00138935 predicted 603
4 SASI_Mm01_00138936 predicted 727
5 SASI_Mm01_00138937 predicted 557
6 SASI_Mm01_00138938 predicted 749
7 SASI_Mm01_00138940 predicted 378
8 SASI_Mm02_00347798 predicted 594
9 SASI_Mm02_00347799 predicted 690
10 SASI_Mm02_00347800 predicted 550
11 SASI_Mm01_00138932 predicted 92
12 SASI_Mm01_00138939 predicted 352
13 SASI_Mm01_00138941 predicted 179
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032936
VALIDATED
TMEM60 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 60
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032936.3-498s21c1
Sequence:CCGGTGCCTCGCACTCTGTGCTAAACTCGAGTTTAGCACAGAGTGCGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032936.3-342s21c1
Sequence:CCGGTTCATTCCAGTCTGGATATTTCTCGAGAAATATCCAGACTGGAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032936.2-659s1c1
Sequence:CCGGGCTGTTCAACAAGTTACCATTCTCGAGAATGGTAACTTGTTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032936.2-690s1c1
Sequence:CCGGGAATCTGTCAAGCTTCAAGAACTCGAGTTCTTGAAGCTTGACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032936.2-586s1c1
Sequence:CCGGGCTTTAACAGAACTCGGATATCTCGAGATATCCGAGTTCTGTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032936.2-430s1c1
Sequence:CCGGCGACATGGATCACACAATATTCTCGAGAATATTGTGTGATCCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032936.2-427s1c1
Sequence:CCGGCCTCGACATGGATCACACAATCTCGAGATTGTGTGATCCATGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032936.2-558s1c1
Sequence:CCGGCATTCCTTTATGGGCCTTGCTCTCGAGAGCAAGGCCCATAAAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032936.2-505s1c1
Sequence:CCGGGCACTCTGTGCTAAACTGGAACTCGAGTTCCAGTTTAGCACAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032936.2-315s1c1
Sequence:CCGGGAAAGCACCTTGGAACTGGTTCTCGAGAACCAGTTCCAAGGTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032936
VALIDATED
TMEM60 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 60
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032936.3-498s21c1
Sequence:CCGGTGCCTCGCACTCTGTGCTAAACTCGAGTTTAGCACAGAGTGCGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032936.3-342s21c1
Sequence:CCGGTTCATTCCAGTCTGGATATTTCTCGAGAAATATCCAGACTGGAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032936.2-659s1c1
Sequence:CCGGGCTGTTCAACAAGTTACCATTCTCGAGAATGGTAACTTGTTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032936.2-690s1c1
Sequence:CCGGGAATCTGTCAAGCTTCAAGAACTCGAGTTCTTGAAGCTTGACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032936.2-586s1c1
Sequence:CCGGGCTTTAACAGAACTCGGATATCTCGAGATATCCGAGTTCTGTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032936.2-430s1c1
Sequence:CCGGCGACATGGATCACACAATATTCTCGAGAATATTGTGTGATCCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032936.2-427s1c1
Sequence:CCGGCCTCGACATGGATCACACAATCTCGAGATTGTGTGATCCATGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032936.2-558s1c1
Sequence:CCGGCATTCCTTTATGGGCCTTGCTCTCGAGAGCAAGGCCCATAAAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032936.2-505s1c1
Sequence:CCGGGCACTCTGTGCTAAACTGGAACTCGAGTTCCAGTTTAGCACAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032936.2-315s1c1
Sequence:CCGGGAAAGCACCTTGGAACTGGTTCTCGAGAACCAGTTCCAAGGTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032936
VALIDATED
TMEM60 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 60
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032936.3-498s21c1
Sequence:CCGGTGCCTCGCACTCTGTGCTAAACTCGAGTTTAGCACAGAGTGCGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032936.3-342s21c1
Sequence:CCGGTTCATTCCAGTCTGGATATTTCTCGAGAAATATCCAGACTGGAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032936.2-659s1c1
Sequence:CCGGGCTGTTCAACAAGTTACCATTCTCGAGAATGGTAACTTGTTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032936.2-690s1c1
Sequence:CCGGGAATCTGTCAAGCTTCAAGAACTCGAGTTCTTGAAGCTTGACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032936.2-586s1c1
Sequence:CCGGGCTTTAACAGAACTCGGATATCTCGAGATATCCGAGTTCTGTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032936.2-430s1c1
Sequence:CCGGCGACATGGATCACACAATATTCTCGAGAATATTGTGTGATCCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032936.2-427s1c1
Sequence:CCGGCCTCGACATGGATCACACAATCTCGAGATTGTGTGATCCATGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032936.2-558s1c1
Sequence:CCGGCATTCCTTTATGGGCCTTGCTCTCGAGAGCAAGGCCCATAAAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032936.2-505s1c1
Sequence:CCGGGCACTCTGTGCTAAACTGGAACTCGAGTTCCAGTTTAGCACAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032936.2-315s1c1
Sequence:CCGGGAAAGCACCTTGGAACTGGTTCTCGAGAACCAGTTCCAAGGTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177601
VALIDATED
TMEM60 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 60
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-453s21c1
Sequence:CCGGCTCGACATGGATCGCACAATACTCGAGTATTGTGCGATCCATGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-369s21c1
Sequence:CCGGTTATTCCAGTCTGGATATTTGCTCGAGCAAATATCCAGACTGGAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-658s21c1
Sequence:CCGGTCCGAGTACATCGTCTCATTTCTCGAGAAATGAGACGATGTACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-613s21c1
Sequence:CCGGTCTAACAGAACTTGGATATAACTCGAGTTATATCCAAGTTCTGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-493s21c1
Sequence:CCGGCCTCATTGCAATGTTACTTAACTCGAGTTAAGTAACATTGCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177601.2-178s1c1
Sequence:CCGGCTTGTCATGCTGATTGTGAAACTCGAGTTTCACAATCAGCATGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177601.2-389s1c1
Sequence:CCGGCTCTAACAGAACTTGGATATACTCGAGTATATCCAAGTTCTGTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177601
VALIDATED
TMEM60 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 60
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-453s21c1
Sequence:CCGGCTCGACATGGATCGCACAATACTCGAGTATTGTGCGATCCATGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-369s21c1
Sequence:CCGGTTATTCCAGTCTGGATATTTGCTCGAGCAAATATCCAGACTGGAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-658s21c1
Sequence:CCGGTCCGAGTACATCGTCTCATTTCTCGAGAAATGAGACGATGTACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-613s21c1
Sequence:CCGGTCTAACAGAACTTGGATATAACTCGAGTTATATCCAAGTTCTGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-493s21c1
Sequence:CCGGCCTCATTGCAATGTTACTTAACTCGAGTTAAGTAACATTGCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177601.2-178s1c1
Sequence:CCGGCTTGTCATGCTGATTGTGAAACTCGAGTTTCACAATCAGCATGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177601.2-389s1c1
Sequence:CCGGCTCTAACAGAACTTGGATATACTCGAGTATATCCAAGTTCTGTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177601
VALIDATED
TMEM60 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 60
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-453s21c1
Sequence:CCGGCTCGACATGGATCGCACAATACTCGAGTATTGTGCGATCCATGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-369s21c1
Sequence:CCGGTTATTCCAGTCTGGATATTTGCTCGAGCAAATATCCAGACTGGAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-658s21c1
Sequence:CCGGTCCGAGTACATCGTCTCATTTCTCGAGAAATGAGACGATGTACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-613s21c1
Sequence:CCGGTCTAACAGAACTTGGATATAACTCGAGTTATATCCAAGTTCTGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177601.3-493s21c1
Sequence:CCGGCCTCATTGCAATGTTACTTAACTCGAGTTAAGTAACATTGCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177601.2-178s1c1
Sequence:CCGGCTTGTCATGCTGATTGTGAAACTCGAGTTTCACAATCAGCATGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177601.2-389s1c1
Sequence:CCGGCTCTAACAGAACTTGGATATACTCGAGTATATCCAAGTTCTGTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks