EMAIL THIS PAGE TO A FRIEND

TMEM61

transmembrane protein 61

UniProtKB ID: Q8N0U2
Gene ID:
Mouse(329909) transmembrane protein 61
Rat(688864) transmembrane protein 61
cow(615684) transmembrane protein 61
sheep(101119272) transmembrane protein 61
chicken(424662) transmembrane protein 61
dog(610503) transmembrane protein 61
domestic cat(101095033) transmembrane protein 61
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182532 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023081 MISSION® esiRNA esiRNA human TMEM61 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182532 Rosetta Predictions human pricing
XM_001068619 Rosetta Predictions rat pricing
XM_001474114 Rosetta Predictions mouse pricing
XM_915910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171453 predicted 429
2 SASI_Hs01_00171454 predicted 547
3 SASI_Hs01_00171455 predicted 661
4 SASI_Hs01_00171456 predicted 587
5 SASI_Hs01_00171457 predicted 708
6 SASI_Hs01_00171458 predicted 457
7 SASI_Hs01_00171459 predicted 314
8 SASI_Hs01_00171460 predicted 366
9 SASI_Hs01_00171461 predicted 582
10 SASI_Hs01_00171462 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325186 predicted 289
2 SASI_Rn02_00325187 predicted 245
3 SASI_Rn02_00325188 predicted 248
4 SASI_Rn02_00325189 predicted 318
5 SASI_Rn02_00325190 predicted 292
6 SASI_Rn02_00325191 predicted 295
7 SASI_Rn02_00325192 predicted 313
8 SASI_Rn02_00325193 predicted 233
9 SASI_Rn02_00325194 predicted 294
10 SASI_Rn02_00325195 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00373111 predicted 1053
2 SASI_Mm02_00373112 predicted 1037
3 SASI_Mm02_00373113 predicted 1046
4 SASI_Mm02_00373114 predicted 990
5 SASI_Mm02_00373115 predicted 897
6 SASI_Mm02_00373116 predicted 898
7 SASI_Mm02_00373117 predicted 1035
8 SASI_Mm02_00373118 predicted 1015
9 SASI_Mm02_00373119 predicted 1028
10 SASI_Mm02_00373120 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439862 predicted 862
2 SASI_Mm02_00439863 predicted 872
3 SASI_Mm02_00439864 predicted 1042
4 SASI_Mm02_00439865 predicted 993
5 SASI_Mm02_00439866 predicted 899
6 SASI_Mm02_00439867 predicted 769
7 SASI_Mm02_00439868 predicted 867
8 SASI_Mm02_00439869 predicted 896
9 SASI_Mm02_00439870 predicted 990
10 SASI_Mm02_00439871 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182532
TMEM61 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 61
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182532.1-320s21c1
Sequence:CCGGCTCCGCTATTGCATGACAGTCCTCGAGGACTGTCATGCAATAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182532.1-795s21c1
Sequence:CCGGCACCCAGCTATGAGAGCATCACTCGAGTGATGCTCTCATAGCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182532.1-947s21c1
Sequence:CCGGGTGCCTTCTCCAGAGTCTTATCTCGAGATAAGACTCTGGAGAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182532.1-667s21c1
Sequence:CCGGTTACGAGGAAGCCGTGAGCTTCTCGAGAAGCTCACGGCTTCCTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182532.1-582s21c1
Sequence:CCGGACCTCTCCAGAGACCTGTACTCTCGAGAGTACAGGTCTCTGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182532
TMEM61 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 61
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182532.1-320s21c1
Sequence:CCGGCTCCGCTATTGCATGACAGTCCTCGAGGACTGTCATGCAATAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182532.1-795s21c1
Sequence:CCGGCACCCAGCTATGAGAGCATCACTCGAGTGATGCTCTCATAGCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182532.1-947s21c1
Sequence:CCGGGTGCCTTCTCCAGAGTCTTATCTCGAGATAAGACTCTGGAGAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182532.1-667s21c1
Sequence:CCGGTTACGAGGAAGCCGTGAGCTTCTCGAGAAGCTCACGGCTTCCTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182532.1-582s21c1
Sequence:CCGGACCTCTCCAGAGACCTGTACTCTCGAGAGTACAGGTCTCTGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182532
TMEM61 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 61
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182532.1-320s21c1
Sequence:CCGGCTCCGCTATTGCATGACAGTCCTCGAGGACTGTCATGCAATAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182532.1-795s21c1
Sequence:CCGGCACCCAGCTATGAGAGCATCACTCGAGTGATGCTCTCATAGCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182532.1-947s21c1
Sequence:CCGGGTGCCTTCTCCAGAGTCTTATCTCGAGATAAGACTCTGGAGAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182532.1-667s21c1
Sequence:CCGGTTACGAGGAAGCCGTGAGCTTCTCGAGAAGCTCACGGCTTCCTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182532.1-582s21c1
Sequence:CCGGACCTCTCCAGAGACCTGTACTCTCGAGAGTACAGGTCTCTGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks