EMAIL THIS PAGE TO A FRIEND

TMEM62

transmembrane protein 62

UniProtKB ID: Q0P6H9, Q6I9Y5, Q9H5J6
Gene ID:
Mouse(96957) transmembrane protein 62
Rat(311350) transmembrane protein 62
Zebrafish(402997) transmembrane protein 62
Horse(100056447) transmembrane protein 62
domestic cat(101081305) transmembrane protein 62
dog(478271) transmembrane protein 62
chicken(423243) transmembrane protein 62
cow(515078) transmembrane protein 62
sheep(101119826) transmembrane protein 62
domestic guinea pig(100723015) transmembrane protein 62
naked mole-rat(101716102) transmembrane protein 62
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024956 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175285 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175285 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175285 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024956 Rosetta Predictions human pricing
XM_001080922 Rosetta Predictions rat pricing
XM_230497 Rosetta Predictions rat pricing
NM_175285 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235106 predicted 851
2 SASI_Hs02_00357616 predicted 992
3 SASI_Hs01_00235108 predicted 798
4 SASI_Hs01_00235109 predicted 1323
5 SASI_Hs01_00235110 predicted 755
6 SASI_Hs01_00235111 predicted 1344
7 SASI_Hs01_00235113 predicted 1130
8 SASI_Hs01_00235115 predicted 2015
9 SASI_Hs02_00357617 predicted 2301
10 SASI_Hs02_00357618 predicted 1006
11 SASI_Hs01_00235107 predicted 1446
12 SASI_Hs01_00235112 predicted 984
13 SASI_Hs01_00235114 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369840 predicted 1441
2 SASI_Rn02_00369841 predicted 734
3 SASI_Rn02_00369842 predicted 704
4 SASI_Rn02_00369843 predicted 961
5 SASI_Rn02_00369844 predicted 1359
6 SASI_Rn02_00369845 predicted 1382
7 SASI_Rn02_00369846 predicted 2121
8 SASI_Rn02_00369847 predicted 951
9 SASI_Rn02_00369848 predicted 1878
10 SASI_Rn02_00369849 predicted 2394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386286 predicted 1438
2 SASI_Rn02_00386287 predicted 729
3 SASI_Rn02_00386288 predicted 702
4 SASI_Rn02_00386289 predicted 963
5 SASI_Rn02_00386290 predicted 1363
6 SASI_Rn02_00386291 predicted 1378
7 SASI_Rn02_00386292 predicted 2118
8 SASI_Rn02_00386293 predicted 957
9 SASI_Rn02_00386294 predicted 1877
10 SASI_Rn02_00386295 predicted 2390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105041 predicted 1296
2 SASI_Mm01_00105042 predicted 569
3 SASI_Mm01_00105043 predicted 1975
4 SASI_Mm02_00346013 predicted 1480
5 SASI_Mm01_00105044 predicted 813
6 SASI_Mm01_00105045 predicted 2103
7 SASI_Mm01_00105046 predicted 963
8 SASI_Mm01_00105047 predicted 1492
9 SASI_Mm01_00105048 predicted 2023
10 SASI_Mm01_00105049 predicted 1393
11 SASI_Mm01_00105050 predicted 1953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024956
VALIDATED
TMEM62 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 62
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024956.3-803s21c1
Sequence:CCGGGTACTCCCTTTGGCAACTATTCTCGAGAATAGTTGCCAAAGGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_024956.3-997s21c1
Sequence:CCGGTCACCAGGAATCCGGTCAATACTCGAGTATTGACCGGATTCCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024956.3-857s21c1
Sequence:CCGGGGCCTAAGAGACCCTATAATTCTCGAGAATTATAGGGTCTCTTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024956.3-2591s21c1
Sequence:CCGGGCAGCTGTCAAAGGTGCAATTCTCGAGAATTGCACCTTTGACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024956.3-1995s21c1
Sequence:CCGGTATGCCTGTTCACCTACTTATCTCGAGATAAGTAGGTGAACAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024956.2-1218s1c1
Sequence:CCGGGCCTGTGGTTCTTATCACCAACTCGAGTTGGTGATAAGAACCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024956.2-2157s1c1
Sequence:CCGGGACACTGAACTCCACCAAGTTCTCGAGAACTTGGTGGAGTTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024956
VALIDATED
TMEM62 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 62
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024956.3-803s21c1
Sequence:CCGGGTACTCCCTTTGGCAACTATTCTCGAGAATAGTTGCCAAAGGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_024956.3-997s21c1
Sequence:CCGGTCACCAGGAATCCGGTCAATACTCGAGTATTGACCGGATTCCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024956.3-857s21c1
Sequence:CCGGGGCCTAAGAGACCCTATAATTCTCGAGAATTATAGGGTCTCTTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024956.3-2591s21c1
Sequence:CCGGGCAGCTGTCAAAGGTGCAATTCTCGAGAATTGCACCTTTGACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024956.3-1995s21c1
Sequence:CCGGTATGCCTGTTCACCTACTTATCTCGAGATAAGTAGGTGAACAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024956.2-1218s1c1
Sequence:CCGGGCCTGTGGTTCTTATCACCAACTCGAGTTGGTGATAAGAACCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024956.2-2157s1c1
Sequence:CCGGGACACTGAACTCCACCAAGTTCTCGAGAACTTGGTGGAGTTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024956
VALIDATED
TMEM62 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 62
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024956.3-803s21c1
Sequence:CCGGGTACTCCCTTTGGCAACTATTCTCGAGAATAGTTGCCAAAGGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_024956.3-997s21c1
Sequence:CCGGTCACCAGGAATCCGGTCAATACTCGAGTATTGACCGGATTCCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024956.3-857s21c1
Sequence:CCGGGGCCTAAGAGACCCTATAATTCTCGAGAATTATAGGGTCTCTTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024956.3-2591s21c1
Sequence:CCGGGCAGCTGTCAAAGGTGCAATTCTCGAGAATTGCACCTTTGACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024956.3-1995s21c1
Sequence:CCGGTATGCCTGTTCACCTACTTATCTCGAGATAAGTAGGTGAACAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024956.2-1218s1c1
Sequence:CCGGGCCTGTGGTTCTTATCACCAACTCGAGTTGGTGATAAGAACCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024956.2-2157s1c1
Sequence:CCGGGACACTGAACTCCACCAAGTTCTCGAGAACTTGGTGGAGTTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175285
VALIDATED
TMEM62 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 62
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175285.2-1791s1c1
Sequence:CCGGGCAGGTTTATTCTTGCTACTTCTCGAGAAGTAGCAAGAATAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175285.2-273s1c1
Sequence:CCGGGAAGTTCTGTTCGGAAACTATCTCGAGATAGTTTCCGAACAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175285.2-368s1c1
Sequence:CCGGCCAGACAACATGAAGTAGAATCTCGAGATTCTACTTCATGTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175285.2-1374s1c1
Sequence:CCGGCACACTGATTACATTCAGATACTCGAGTATCTGAATGTAATCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175285
VALIDATED
TMEM62 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 62
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175285.2-1791s1c1
Sequence:CCGGGCAGGTTTATTCTTGCTACTTCTCGAGAAGTAGCAAGAATAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175285.2-273s1c1
Sequence:CCGGGAAGTTCTGTTCGGAAACTATCTCGAGATAGTTTCCGAACAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175285.2-368s1c1
Sequence:CCGGCCAGACAACATGAAGTAGAATCTCGAGATTCTACTTCATGTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175285.2-1374s1c1
Sequence:CCGGCACACTGATTACATTCAGATACTCGAGTATCTGAATGTAATCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175285
VALIDATED
TMEM62 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 62
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175285.2-1791s1c1
Sequence:CCGGGCAGGTTTATTCTTGCTACTTCTCGAGAAGTAGCAAGAATAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175285.2-273s1c1
Sequence:CCGGGAAGTTCTGTTCGGAAACTATCTCGAGATAGTTTCCGAACAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175285.2-368s1c1
Sequence:CCGGCCAGACAACATGAAGTAGAATCTCGAGATTCTACTTCATGTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175285.2-1374s1c1
Sequence:CCGGCACACTGATTACATTCAGATACTCGAGTATCTGAATGTAATCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks