EMAIL THIS PAGE TO A FRIEND

TMEM63A

transmembrane protein 63A

Synonyms: KIAA0792
UniProtKB ID: O94886, Q53GI7, Q5TE96, Q8N2U2
Gene ID:
Mouse(208795) transmembrane protein 63a
Rat(289318) transmembrane protein 63a
naked mole-rat(101697090) transmembrane protein 63A
Domestic Rabbit(100352435) transmembrane protein 63A
domestic guinea pig(100720287) transmembrane protein 63A
cow(534017) transmembrane protein 63A
sheep(101111305) transmembrane protein 63A
Zebrafish(557924) transmembrane protein 63A
chicken(421319) transmembrane protein 63A
Horse(100057436) transmembrane protein 63A
domestic cat(101085772) transmembrane protein 63A
dog(490389) transmembrane protein 63A
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0276 AQUA Peptide QTLFITGLP[R] mouse, rat pricing
AQ0277 AQUA Peptide TALSPQQQQTYGAI[R] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014698 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014698 Rosetta Predictions human pricing
NM_001134496 Rosetta Predictions rat pricing
NM_144794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117015 predicted 1408
2 SASI_Hs01_00117016 predicted 1586
3 SASI_Hs01_00117017 predicted 760
4 SASI_Hs01_00117018 predicted 1764
5 SASI_Hs01_00117019 predicted 523
6 SASI_Hs01_00117020 predicted 1434
7 SASI_Hs01_00117021 predicted 721
8 SASI_Hs01_00117022 predicted 598
9 SASI_Hs01_00117023 predicted 2143
10 SASI_Hs01_00117024 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256449 predicted 1159
2 SASI_Rn02_00256450 predicted 847
3 SASI_Rn02_00256451 predicted 2536
4 SASI_Rn02_00256452 predicted 1553
5 SASI_Rn02_00256453 predicted 1612
6 SASI_Rn02_00256454 predicted 1067
7 SASI_Rn02_00256455 predicted 947
8 SASI_Rn02_00256456 predicted 2510
9 SASI_Rn02_00256457 predicted 2580
10 SASI_Rn02_00256458 predicted 2246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340132 predicted 2438
2 SASI_Mm02_00340133 predicted 1131
3 SASI_Mm01_00194680 predicted 2453
4 SASI_Mm01_00194681 predicted 1545
5 SASI_Mm01_00194682 predicted 1318
6 SASI_Mm01_00194683 predicted 1003
7 SASI_Mm01_00194684 predicted 536
8 SASI_Mm01_00194685 predicted 2504
9 SASI_Mm01_00194686 predicted 678
10 SASI_Mm01_00194687 predicted 2239
11 SASI_Mm01_00194679 predicted 554
12 SASI_Mm01_00194688 predicted 568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144794
VALIDATED
TMEM63A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 63A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144794.1-2577s1c1
Sequence:CCGGCCGTATTGTGAGAAGAGGAAACTCGAGTTTCCTCTTCTCACAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144794.1-1790s1c1
Sequence:CCGGCCTCTATACCTTCCGCATGATCTCGAGATCATGCGGAAGGTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144794.1-2253s1c1
Sequence:CCGGGCTAGTGACAAAGGAAGCGAACTCGAGTTCGCTTCCTTTGTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144794.1-219s1c1
Sequence:CCGGCTCTTAGATGTCAGTTGCTTTCTCGAGAAAGCAACTGACATCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144794.1-240s1c1
Sequence:CCGGCTGTTTCTAATCCTGGTGTTTCTCGAGAAACACCAGGATTAGAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-2253s21c1
Sequence:CCGGGCTAGTGACAAAGGAAGCGAACTCGAGTTCGCTTCCTTTGTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-2841s21c1
Sequence:CCGGGCCTTTAGGGAGATCATATTTCTCGAGAAATATGATCTCCCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-131s21c1
Sequence:CCGGACGTCCCAATGACTCCTATTGCTCGAGCAATAGGAGTCATTGGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-889s21c1
Sequence:CCGGCCGAGAAGAGCCTTACCTATTCTCGAGAATAGGTAAGGCTCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-1790s21c1
Sequence:CCGGCCTCTATACCTTCCGCATGATCTCGAGATCATGCGGAAGGTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144794
VALIDATED
TMEM63A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 63A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144794.1-2577s1c1
Sequence:CCGGCCGTATTGTGAGAAGAGGAAACTCGAGTTTCCTCTTCTCACAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144794.1-1790s1c1
Sequence:CCGGCCTCTATACCTTCCGCATGATCTCGAGATCATGCGGAAGGTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144794.1-2253s1c1
Sequence:CCGGGCTAGTGACAAAGGAAGCGAACTCGAGTTCGCTTCCTTTGTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144794.1-219s1c1
Sequence:CCGGCTCTTAGATGTCAGTTGCTTTCTCGAGAAAGCAACTGACATCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144794.1-240s1c1
Sequence:CCGGCTGTTTCTAATCCTGGTGTTTCTCGAGAAACACCAGGATTAGAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-2253s21c1
Sequence:CCGGGCTAGTGACAAAGGAAGCGAACTCGAGTTCGCTTCCTTTGTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-2841s21c1
Sequence:CCGGGCCTTTAGGGAGATCATATTTCTCGAGAAATATGATCTCCCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-131s21c1
Sequence:CCGGACGTCCCAATGACTCCTATTGCTCGAGCAATAGGAGTCATTGGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-889s21c1
Sequence:CCGGCCGAGAAGAGCCTTACCTATTCTCGAGAATAGGTAAGGCTCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-1790s21c1
Sequence:CCGGCCTCTATACCTTCCGCATGATCTCGAGATCATGCGGAAGGTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144794
VALIDATED
TMEM63A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 63A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144794.1-2577s1c1
Sequence:CCGGCCGTATTGTGAGAAGAGGAAACTCGAGTTTCCTCTTCTCACAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144794.1-1790s1c1
Sequence:CCGGCCTCTATACCTTCCGCATGATCTCGAGATCATGCGGAAGGTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144794.1-2253s1c1
Sequence:CCGGGCTAGTGACAAAGGAAGCGAACTCGAGTTCGCTTCCTTTGTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144794.1-219s1c1
Sequence:CCGGCTCTTAGATGTCAGTTGCTTTCTCGAGAAAGCAACTGACATCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144794.1-240s1c1
Sequence:CCGGCTGTTTCTAATCCTGGTGTTTCTCGAGAAACACCAGGATTAGAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-2253s21c1
Sequence:CCGGGCTAGTGACAAAGGAAGCGAACTCGAGTTCGCTTCCTTTGTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-2841s21c1
Sequence:CCGGGCCTTTAGGGAGATCATATTTCTCGAGAAATATGATCTCCCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-131s21c1
Sequence:CCGGACGTCCCAATGACTCCTATTGCTCGAGCAATAGGAGTCATTGGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-889s21c1
Sequence:CCGGCCGAGAAGAGCCTTACCTATTCTCGAGAATAGGTAAGGCTCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144794.2-1790s21c1
Sequence:CCGGCCTCTATACCTTCCGCATGATCTCGAGATCATGCGGAAGGTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014698
TMEM63A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 63A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014698.1-2092s1c1
Sequence:CCGGGCTGTGTGTCTTCACTGTCATCTCGAGATGACAGTGAAGACACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014698.1-517s1c1
Sequence:CCGGCGAGTCCAGATTTCAGAGATTCTCGAGAATCTCTGAAATCTGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014698.1-433s1c1
Sequence:CCGGCCTGTTCTTAATCTTGGTGTTCTCGAGAACACCAAGATTAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014698.1-1210s1c1
Sequence:CCGGCATCTCTTACTACACACGGATCTCGAGATCCGTGTGTAGTAAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014698.1-3282s1c1
Sequence:CCGGGACCACTCATAATATGCCCATCTCGAGATGGGCATATTATGAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014698.1-1096s1c1
Sequence:CCGGCCTGACCTATTACACAAACCTCTCGAGAGGTTTGTGTAATAGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014698.1-1209s1c1
Sequence:CCGGCCATCTCTTACTACACACGGACTCGAGTCCGTGTGTAGTAAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014698
TMEM63A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 63A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014698.1-2092s1c1
Sequence:CCGGGCTGTGTGTCTTCACTGTCATCTCGAGATGACAGTGAAGACACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014698.1-517s1c1
Sequence:CCGGCGAGTCCAGATTTCAGAGATTCTCGAGAATCTCTGAAATCTGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014698.1-433s1c1
Sequence:CCGGCCTGTTCTTAATCTTGGTGTTCTCGAGAACACCAAGATTAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014698.1-1210s1c1
Sequence:CCGGCATCTCTTACTACACACGGATCTCGAGATCCGTGTGTAGTAAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014698.1-3282s1c1
Sequence:CCGGGACCACTCATAATATGCCCATCTCGAGATGGGCATATTATGAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014698.1-1096s1c1
Sequence:CCGGCCTGACCTATTACACAAACCTCTCGAGAGGTTTGTGTAATAGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014698.1-1209s1c1
Sequence:CCGGCCATCTCTTACTACACACGGACTCGAGTCCGTGTGTAGTAAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014698
TMEM63A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 63A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014698.1-2092s1c1
Sequence:CCGGGCTGTGTGTCTTCACTGTCATCTCGAGATGACAGTGAAGACACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014698.1-517s1c1
Sequence:CCGGCGAGTCCAGATTTCAGAGATTCTCGAGAATCTCTGAAATCTGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014698.1-433s1c1
Sequence:CCGGCCTGTTCTTAATCTTGGTGTTCTCGAGAACACCAAGATTAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014698.1-1210s1c1
Sequence:CCGGCATCTCTTACTACACACGGATCTCGAGATCCGTGTGTAGTAAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014698.1-3282s1c1
Sequence:CCGGGACCACTCATAATATGCCCATCTCGAGATGGGCATATTATGAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014698.1-1096s1c1
Sequence:CCGGCCTGACCTATTACACAAACCTCTCGAGAGGTTTGTGTAATAGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014698.1-1209s1c1
Sequence:CCGGCCATCTCTTACTACACACGGACTCGAGTCCGTGTGTAGTAAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks