EMAIL THIS PAGE TO A FRIEND

TMEM63B

transmembrane protein 63B

Synonyms: C6orf110 RP3-421H19.2
Gene ID:
Mouse(224807) transmembrane protein 63b
Rat(363197) transmembrane protein 63B
chicken(421442) transmembrane protein 63B
Horse(100067695) transmembrane protein 63B
domestic cat(101095338) transmembrane protein 63B
dog(609620) transmembrane protein 63B
cow(534891) transmembrane protein 63B
Goat(100861329) transmembrane protein 63B
sheep(101113706) transmembrane protein 63B
domestic guinea pig(100730753) transmembrane protein 63B
naked mole-rat(101703819) transmembrane protein 63B
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018426 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018426 Rosetta Predictions human pricing
XM_001064861 Rosetta Predictions rat pricing
XM_001064906 Rosetta Predictions rat pricing
XM_343537 Rosetta Predictions rat pricing
NM_198167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133184 predicted 657
2 SASI_Hs02_00351938 predicted 797
3 SASI_Hs01_00133185 predicted 1787
4 SASI_Hs01_00133186 predicted 372
5 SASI_Hs01_00133187 predicted 2622
6 SASI_Hs01_00133190 predicted 1198
7 SASI_Hs01_00133191 predicted 2187
8 SASI_Hs01_00133192 predicted 336
9 SASI_Hs02_00351939 predicted 1055
10 SASI_Hs02_00351940 predicted 1755
11 SASI_Hs01_00133188 predicted 435
12 SASI_Hs01_00133189 predicted 804
13 SASI_Hs01_00133193 predicted 2549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312008 predicted 807
2 SASI_Rn02_00312009 predicted 1059
3 SASI_Rn02_00312010 predicted 659
4 SASI_Rn02_00312011 predicted 1795
5 SASI_Rn02_00312012 predicted 649
6 SASI_Rn02_00312013 predicted 1286
7 SASI_Rn02_00312014 predicted 884
8 SASI_Rn02_00312015 predicted 762
9 SASI_Rn02_00312016 predicted 1180
10 SASI_Rn02_00312017 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312210 predicted 1055
2 SASI_Rn02_00312211 predicted 878
3 SASI_Rn02_00312212 predicted 1160
4 SASI_Rn02_00312213 predicted 1051
5 SASI_Rn02_00312214 predicted 732
6 SASI_Rn02_00312215 predicted 1885
7 SASI_Rn02_00312216 predicted 719
8 SASI_Rn02_00312217 predicted 1388
9 SASI_Rn02_00312218 predicted 961
10 SASI_Rn02_00312219 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141447 predicted 1342
2 SASI_Rn01_00141448 predicted 1203
3 SASI_Rn01_00141449 predicted 2322
4 SASI_Rn01_00141450 predicted 2923
5 SASI_Rn01_00141451 predicted 1180
6 SASI_Rn01_00141452 predicted 1829
7 SASI_Rn01_00141453 predicted 1416
8 SASI_Rn01_00141454 predicted 1297
9 SASI_Rn01_00141455 predicted 2256
10 SASI_Rn01_00141456 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045782 predicted 787
2 SASI_Mm01_00045783 predicted 725
3 SASI_Mm01_00045784 predicted 647
4 SASI_Mm02_00350877 predicted 625
5 SASI_Mm01_00045785 predicted 1914
6 SASI_Mm01_00045786 predicted 2226
7 SASI_Mm01_00045787 predicted 865
8 SASI_Mm01_00045788 predicted 742
9 SASI_Mm01_00045790 predicted 1040
10 SASI_Mm01_00045791 predicted 394
11 SASI_Mm01_00045789 predicted 1661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198167
VALIDATED
TMEM63B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 63B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198167.3-856s21c1
Sequence:CCGGATCAATGGAATCTCCAAATATCTCGAGATATTTGGAGATTCCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-2743s21c1
Sequence:CCGGCTGCTTTCATTAAGGTATTTACTCGAGTAAATACCTTAATGAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-1829s21c1
Sequence:CCGGTCTTCGTGAACTACGTCATTGCTCGAGCAATGACGTAGTTCACGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-951s21c1
Sequence:CCGGTTACAACGTGGCTCGACTTATCTCGAGATAAGTCGAGCCACGTTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-2906s21c1
Sequence:CCGGTGTGGCCAGGAAAGGGTTAATCTCGAGATTAACCCTTTCCTGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-461s21c1
Sequence:CCGGTCTCCAGCTCTGTCGACTTTGCTCGAGCAAAGTCGACAGAGCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198167.1-186s1c1
Sequence:CCGGCTGGACTTCATGTGCTTTCTTCTCGAGAAGAAAGCACATGAAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198167.1-633s1c1
Sequence:CCGGGCCAACTTGAAATCAGGGAATCTCGAGATTCCCTGATTTCAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198167.1-1290s1c1
Sequence:CCGGCCTCAGAACATCTATTGGGAACTCGAGTTCCCAATAGATGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198167.1-2621s1c1
Sequence:CCGGGCTCCTACCTTATCACCACTACTCGAGTAGTGGTGATAAGGTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198167
VALIDATED
TMEM63B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 63B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198167.3-856s21c1
Sequence:CCGGATCAATGGAATCTCCAAATATCTCGAGATATTTGGAGATTCCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-2743s21c1
Sequence:CCGGCTGCTTTCATTAAGGTATTTACTCGAGTAAATACCTTAATGAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-1829s21c1
Sequence:CCGGTCTTCGTGAACTACGTCATTGCTCGAGCAATGACGTAGTTCACGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-951s21c1
Sequence:CCGGTTACAACGTGGCTCGACTTATCTCGAGATAAGTCGAGCCACGTTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-2906s21c1
Sequence:CCGGTGTGGCCAGGAAAGGGTTAATCTCGAGATTAACCCTTTCCTGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-461s21c1
Sequence:CCGGTCTCCAGCTCTGTCGACTTTGCTCGAGCAAAGTCGACAGAGCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198167.1-186s1c1
Sequence:CCGGCTGGACTTCATGTGCTTTCTTCTCGAGAAGAAAGCACATGAAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198167.1-633s1c1
Sequence:CCGGGCCAACTTGAAATCAGGGAATCTCGAGATTCCCTGATTTCAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198167.1-1290s1c1
Sequence:CCGGCCTCAGAACATCTATTGGGAACTCGAGTTCCCAATAGATGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198167.1-2621s1c1
Sequence:CCGGGCTCCTACCTTATCACCACTACTCGAGTAGTGGTGATAAGGTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198167
VALIDATED
TMEM63B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 63B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198167.3-856s21c1
Sequence:CCGGATCAATGGAATCTCCAAATATCTCGAGATATTTGGAGATTCCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-2743s21c1
Sequence:CCGGCTGCTTTCATTAAGGTATTTACTCGAGTAAATACCTTAATGAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-1829s21c1
Sequence:CCGGTCTTCGTGAACTACGTCATTGCTCGAGCAATGACGTAGTTCACGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-951s21c1
Sequence:CCGGTTACAACGTGGCTCGACTTATCTCGAGATAAGTCGAGCCACGTTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-2906s21c1
Sequence:CCGGTGTGGCCAGGAAAGGGTTAATCTCGAGATTAACCCTTTCCTGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198167.3-461s21c1
Sequence:CCGGTCTCCAGCTCTGTCGACTTTGCTCGAGCAAAGTCGACAGAGCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198167.1-186s1c1
Sequence:CCGGCTGGACTTCATGTGCTTTCTTCTCGAGAAGAAAGCACATGAAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198167.1-633s1c1
Sequence:CCGGGCCAACTTGAAATCAGGGAATCTCGAGATTCCCTGATTTCAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_198167.1-1290s1c1
Sequence:CCGGCCTCAGAACATCTATTGGGAACTCGAGTTCCCAATAGATGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198167.1-2621s1c1
Sequence:CCGGGCTCCTACCTTATCACCACTACTCGAGTAGTGGTGATAAGGTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018426
VALIDATED
TMEM63B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 63B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018426.1-2245s1c1
Sequence:CCGGCGTCTGCTTTGGACACTTCAACTCGAGTTGAAGTGTCCAAAGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018426.1-807s1c1
Sequence:CCGGCCAAATATGCAGAGTCAGAAACTCGAGTTTCTGACTCTGCATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018426.1-2671s1c1
Sequence:CCGGCCCTGCTTTCATTAAGGTATTCTCGAGAATACCTTAATGAAAGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018426.1-637s1c1
Sequence:CCGGGAGAACCACCATTGCCAACTTCTCGAGAAGTTGGCAATGGTGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018426.1-405s1c1
Sequence:CCGGGCTCCGTTGACTTTGACCAAACTCGAGTTTGGTCAAAGTCAACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018426.1-652s1c1
Sequence:CCGGCAACTTGAAATCAGGGAACAACTCGAGTTGTTCCCTGATTTCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018426.1-2853s1c1
Sequence:CCGGGAGGGTTAATGAGAGCCAAGACTCGAGTCTTGGCTCTCATTAACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018426.1-2032s1c1
Sequence:CCGGCCTGGTAGACAGGTACAATCTCTCGAGAGATTGTACCTGTCTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018426
VALIDATED
TMEM63B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 63B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018426.1-2245s1c1
Sequence:CCGGCGTCTGCTTTGGACACTTCAACTCGAGTTGAAGTGTCCAAAGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018426.1-807s1c1
Sequence:CCGGCCAAATATGCAGAGTCAGAAACTCGAGTTTCTGACTCTGCATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018426.1-2671s1c1
Sequence:CCGGCCCTGCTTTCATTAAGGTATTCTCGAGAATACCTTAATGAAAGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018426.1-637s1c1
Sequence:CCGGGAGAACCACCATTGCCAACTTCTCGAGAAGTTGGCAATGGTGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018426.1-405s1c1
Sequence:CCGGGCTCCGTTGACTTTGACCAAACTCGAGTTTGGTCAAAGTCAACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018426.1-652s1c1
Sequence:CCGGCAACTTGAAATCAGGGAACAACTCGAGTTGTTCCCTGATTTCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018426.1-2853s1c1
Sequence:CCGGGAGGGTTAATGAGAGCCAAGACTCGAGTCTTGGCTCTCATTAACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018426.1-2032s1c1
Sequence:CCGGCCTGGTAGACAGGTACAATCTCTCGAGAGATTGTACCTGTCTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018426
VALIDATED
TMEM63B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 63B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018426.1-2245s1c1
Sequence:CCGGCGTCTGCTTTGGACACTTCAACTCGAGTTGAAGTGTCCAAAGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018426.1-807s1c1
Sequence:CCGGCCAAATATGCAGAGTCAGAAACTCGAGTTTCTGACTCTGCATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018426.1-2671s1c1
Sequence:CCGGCCCTGCTTTCATTAAGGTATTCTCGAGAATACCTTAATGAAAGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018426.1-637s1c1
Sequence:CCGGGAGAACCACCATTGCCAACTTCTCGAGAAGTTGGCAATGGTGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018426.1-405s1c1
Sequence:CCGGGCTCCGTTGACTTTGACCAAACTCGAGTTTGGTCAAAGTCAACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018426.1-652s1c1
Sequence:CCGGCAACTTGAAATCAGGGAACAACTCGAGTTGTTCCCTGATTTCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018426.1-2853s1c1
Sequence:CCGGGAGGGTTAATGAGAGCCAAGACTCGAGTCTTGGCTCTCATTAACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018426.1-2032s1c1
Sequence:CCGGCCTGGTAGACAGGTACAATCTCTCGAGAGATTGTACCTGTCTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks