EMAIL THIS PAGE TO A FRIEND

TMEM63C

transmembrane protein 63C

Synonyms: C14orf171
Gene ID:
Mouse(217733) transmembrane protein 63c
Rat(314332) transmembrane protein 63c
chicken(423372) transmembrane protein 63C
dog(490804) transmembrane protein 63C
domestic cat(101100895) transmembrane protein 63C
naked mole-rat(101707514) transmembrane protein 63C
domestic guinea pig(100726399) transmembrane protein 63C
cow(614000) transmembrane protein 63C
sheep(101113242) transmembrane protein 63C
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA030657 Anti-TMEM63C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2103855 Anti-TMEM63C antibody produced in rabbit affinity isolated antibody human, rat, mouse, guinea pig, horse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020431 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020431 Rosetta Predictions human pricing
NM_001108045 Rosetta Predictions rat pricing
NM_172583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196050 predicted 2230
2 SASI_Hs01_00196052 predicted 802
3 SASI_Hs01_00196054 predicted 607
4 SASI_Hs01_00196055 predicted 1103
5 SASI_Hs01_00196056 predicted 2035
6 SASI_Hs02_00353445 predicted 1117
7 SASI_Hs01_00196057 predicted 1701
8 SASI_Hs01_00196058 predicted 666
9 SASI_Hs01_00196059 predicted 1892
10 SASI_Hs02_00353446 predicted 1799
11 SASI_Hs01_00196051 predicted 1630
12 SASI_Hs01_00196053 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234815 predicted 1198
2 SASI_Rn02_00234816 predicted 2096
3 SASI_Rn02_00234817 predicted 2045
4 SASI_Rn02_00234818 predicted 2364
5 SASI_Rn02_00234819 predicted 1168
6 SASI_Rn02_00234820 predicted 2530
7 SASI_Rn02_00234821 predicted 1332
8 SASI_Rn02_00234822 predicted 2333
9 SASI_Rn02_00234823 predicted 1508
10 SASI_Rn02_00234824 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084725 predicted 1778
2 SASI_Mm01_00084726 predicted 1907
3 SASI_Mm01_00084728 predicted 2096
4 SASI_Mm02_00344261 predicted 901
5 SASI_Mm01_00084729 predicted 2185
6 SASI_Mm01_00084730 predicted 759
7 SASI_Mm02_00344262 predicted 2000
8 SASI_Mm02_00344263 predicted 2041
9 SASI_Mm01_00084731 predicted 1272
10 SASI_Mm01_00084732 predicted 931
11 SASI_Mm01_00084727 predicted 691
12 SASI_Mm01_00084733 predicted 2077
13 SASI_Mm01_00084734 predicted 1064
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172583
TMEM63C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 63C
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000194499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172583.2-447s1c1
Sequence:CCGGGTGTTCGTTGTCCTGCTTTATCTCGAGATAAAGCAGGACAACGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172583.2-3168s1c1
Sequence:CCGGGCATCTAGAAACTCTGTACTTCTCGAGAAGTACAGAGTTTCTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172583.2-2192s1c1
Sequence:CCGGGCACATTACAGACCGCTATAACTCGAGTTATAGCGGTCTGTAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172583.2-422s1c1
Sequence:CCGGGCTCGTACTCAACATCATCTTCTCGAGAAGATGATGTTGAGTACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172583
TMEM63C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 63C
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000194499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172583.2-447s1c1
Sequence:CCGGGTGTTCGTTGTCCTGCTTTATCTCGAGATAAAGCAGGACAACGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172583.2-3168s1c1
Sequence:CCGGGCATCTAGAAACTCTGTACTTCTCGAGAAGTACAGAGTTTCTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172583.2-2192s1c1
Sequence:CCGGGCACATTACAGACCGCTATAACTCGAGTTATAGCGGTCTGTAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172583.2-422s1c1
Sequence:CCGGGCTCGTACTCAACATCATCTTCTCGAGAAGATGATGTTGAGTACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172583
TMEM63C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 63C
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000194499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172583.2-447s1c1
Sequence:CCGGGTGTTCGTTGTCCTGCTTTATCTCGAGATAAAGCAGGACAACGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172583.2-3168s1c1
Sequence:CCGGGCATCTAGAAACTCTGTACTTCTCGAGAAGTACAGAGTTTCTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172583.2-2192s1c1
Sequence:CCGGGCACATTACAGACCGCTATAACTCGAGTTATAGCGGTCTGTAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172583.2-422s1c1
Sequence:CCGGGCTCGTACTCAACATCATCTTCTCGAGAAGATGATGTTGAGTACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020431
TMEM63C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 63C
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020431.1-3154s1c1
Sequence:CCGGCGTAGACCTGAGAAGAGGTAACTCGAGTTACCTCTTCTCAGGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165343    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020431.1-3471s1c1
Sequence:CCGGGCCAAAGATGTGGCCACTTAACTCGAGTTAAGTGGCCACATCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020431.1-4537s1c1
Sequence:CCGGCCATCATGTGTATTTGGTGTACTCGAGTACACCAAATACACATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158562    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020431.1-3235s1c1
Sequence:CCGGCCCTTCTTTCTATTCTTACAACTCGAGTTGTAAGAATAGAAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020431.1-838s1c1
Sequence:CCGGGAAGACCCAGAACTCATCATTCTCGAGAATGATGAGTTCTGGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020431.1-1625s1c1
Sequence:CCGGGCTACATCTTTCTGGTGTTCACTCGAGTGAACACCAGAAAGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020431.1-187s1c1
Sequence:CCGGCAGAACATGACAGTGGATGAACTCGAGTTCATCCACTGTCATGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020431.1-1206s1c1
Sequence:CCGGGCGTGTCCGTAAGGATTACAACTCGAGTTGTAATCCTTACGGACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020431.2-2105s21c1
Sequence:CCGGGCACTTGACGGATCGCTATAACTCGAGTTATAGCGATCCGTCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020431.2-1768s21c1
Sequence:CCGGGGCTCTTTGACATCTACTATCCTCGAGGATAGTAGATGTCAAAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020431.2-1330s21c1
Sequence:CCGGCAGTGACCACCATCGTCAAATCTCGAGATTTGACGATGGTGGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020431
TMEM63C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 63C
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020431.1-3154s1c1
Sequence:CCGGCGTAGACCTGAGAAGAGGTAACTCGAGTTACCTCTTCTCAGGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165343    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020431.1-3471s1c1
Sequence:CCGGGCCAAAGATGTGGCCACTTAACTCGAGTTAAGTGGCCACATCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020431.1-4537s1c1
Sequence:CCGGCCATCATGTGTATTTGGTGTACTCGAGTACACCAAATACACATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158562    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020431.1-3235s1c1
Sequence:CCGGCCCTTCTTTCTATTCTTACAACTCGAGTTGTAAGAATAGAAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020431.1-838s1c1
Sequence:CCGGGAAGACCCAGAACTCATCATTCTCGAGAATGATGAGTTCTGGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020431.1-1625s1c1
Sequence:CCGGGCTACATCTTTCTGGTGTTCACTCGAGTGAACACCAGAAAGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020431.1-187s1c1
Sequence:CCGGCAGAACATGACAGTGGATGAACTCGAGTTCATCCACTGTCATGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020431.1-1206s1c1
Sequence:CCGGGCGTGTCCGTAAGGATTACAACTCGAGTTGTAATCCTTACGGACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020431.2-2105s21c1
Sequence:CCGGGCACTTGACGGATCGCTATAACTCGAGTTATAGCGATCCGTCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020431.2-1768s21c1
Sequence:CCGGGGCTCTTTGACATCTACTATCCTCGAGGATAGTAGATGTCAAAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020431.2-1330s21c1
Sequence:CCGGCAGTGACCACCATCGTCAAATCTCGAGATTTGACGATGGTGGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020431
TMEM63C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 63C
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020431.1-3154s1c1
Sequence:CCGGCGTAGACCTGAGAAGAGGTAACTCGAGTTACCTCTTCTCAGGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165343    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020431.1-3471s1c1
Sequence:CCGGGCCAAAGATGTGGCCACTTAACTCGAGTTAAGTGGCCACATCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020431.1-4537s1c1
Sequence:CCGGCCATCATGTGTATTTGGTGTACTCGAGTACACCAAATACACATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158562    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020431.1-3235s1c1
Sequence:CCGGCCCTTCTTTCTATTCTTACAACTCGAGTTGTAAGAATAGAAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020431.1-838s1c1
Sequence:CCGGGAAGACCCAGAACTCATCATTCTCGAGAATGATGAGTTCTGGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020431.1-1625s1c1
Sequence:CCGGGCTACATCTTTCTGGTGTTCACTCGAGTGAACACCAGAAAGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020431.1-187s1c1
Sequence:CCGGCAGAACATGACAGTGGATGAACTCGAGTTCATCCACTGTCATGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020431.1-1206s1c1
Sequence:CCGGGCGTGTCCGTAAGGATTACAACTCGAGTTGTAATCCTTACGGACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020431.2-2105s21c1
Sequence:CCGGGCACTTGACGGATCGCTATAACTCGAGTTATAGCGATCCGTCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020431.2-1768s21c1
Sequence:CCGGGGCTCTTTGACATCTACTATCCTCGAGGATAGTAGATGTCAAAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020431.2-1330s21c1
Sequence:CCGGCAGTGACCACCATCGTCAAATCTCGAGATTTGACGATGGTGGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks