EMAIL THIS PAGE TO A FRIEND

TMEM64

transmembrane protein 64

UniProtKB ID: Q6YI46, B4DUC0, F5GXM4, Q2HIZ7, Q8N3G6
Gene ID:
Mouse(100201) transmembrane protein 64
cow(536822) transmembrane protein 64
sheep(101111814) transmembrane protein 64
domestic guinea pig(100715004) transmembrane protein 64
naked mole-rat(101708272) transmembrane protein 64
Zebrafish(564172) transmembrane protein 64
domestic cat(101087554) transmembrane protein 64
dog(487040) transmembrane protein 64
chicken(770964) transmembrane protein 64
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008495 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181401 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181401 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181401 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008495 Rosetta Predictions human pricing
NM_181401 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164056 predicted 522
2 SASI_Hs01_00164057 predicted 494
3 SASI_Hs01_00164058 predicted 545
4 SASI_Hs01_00164059 predicted 810
5 SASI_Hs01_00164060 predicted 682
6 SASI_Hs01_00164061 predicted 789
7 SASI_Hs01_00164062 predicted 485
8 SASI_Hs02_00305479 predicted 840
9 SASI_Hs01_00164064 predicted 596
10 SASI_Hs01_00164065 predicted 716
11 SASI_Hs01_00164063 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192678 predicted 813
2 SASI_Mm01_00192679 predicted 659
3 SASI_Mm01_00192681 predicted 1180
4 SASI_Mm01_00192682 predicted 814
5 SASI_Mm01_00192683 predicted 1140
6 SASI_Mm01_00192684 predicted 1124
7 SASI_Mm01_00192685 predicted 1689
8 SASI_Mm01_00192686 predicted 827
9 SASI_Mm01_00192687 predicted 1154
10 SASI_Mm02_00349740 predicted 1195
11 SASI_Mm01_00192680 predicted 862
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008495
VALIDATED
TMEM64 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 64
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008495.2-597s21c1
Sequence:CCGGCGATTACTGATCTCTCATTACCTCGAGGTAATGAGAGATCAGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008495.2-718s21c1
Sequence:CCGGACAGAGTGTTAGTGGATATTTCTCGAGAAATATCCACTAACACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008495.2-488s21c1
Sequence:CCGGGAGAAGCTGAGCGCGGTTATTCTCGAGAATAACCGCGCTCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008495.2-843s21c1
Sequence:CCGGTGAAATCTTCTCTGGTTAAAGCTCGAGCTTTAACCAGAGAAGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008495.2-2430s21c1
Sequence:CCGGTTTGCTCTATCAGGTATAATTCTCGAGAATTATACCTGATAGAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008495.1-808s1c1
Sequence:CCGGGAATTGAATGCAGCTATTGTACTCGAGTACAATAGCTGCATTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008495.1-555s1c1
Sequence:CCGGCAGACTGACACCCATACCTTTCTCGAGAAAGGTATGGGTGTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008495
VALIDATED
TMEM64 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 64
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008495.2-597s21c1
Sequence:CCGGCGATTACTGATCTCTCATTACCTCGAGGTAATGAGAGATCAGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008495.2-718s21c1
Sequence:CCGGACAGAGTGTTAGTGGATATTTCTCGAGAAATATCCACTAACACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008495.2-488s21c1
Sequence:CCGGGAGAAGCTGAGCGCGGTTATTCTCGAGAATAACCGCGCTCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008495.2-843s21c1
Sequence:CCGGTGAAATCTTCTCTGGTTAAAGCTCGAGCTTTAACCAGAGAAGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008495.2-2430s21c1
Sequence:CCGGTTTGCTCTATCAGGTATAATTCTCGAGAATTATACCTGATAGAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008495.1-808s1c1
Sequence:CCGGGAATTGAATGCAGCTATTGTACTCGAGTACAATAGCTGCATTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008495.1-555s1c1
Sequence:CCGGCAGACTGACACCCATACCTTTCTCGAGAAAGGTATGGGTGTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008495
VALIDATED
TMEM64 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 64
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008495.2-597s21c1
Sequence:CCGGCGATTACTGATCTCTCATTACCTCGAGGTAATGAGAGATCAGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008495.2-718s21c1
Sequence:CCGGACAGAGTGTTAGTGGATATTTCTCGAGAAATATCCACTAACACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008495.2-488s21c1
Sequence:CCGGGAGAAGCTGAGCGCGGTTATTCTCGAGAATAACCGCGCTCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008495.2-843s21c1
Sequence:CCGGTGAAATCTTCTCTGGTTAAAGCTCGAGCTTTAACCAGAGAAGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008495.2-2430s21c1
Sequence:CCGGTTTGCTCTATCAGGTATAATTCTCGAGAATTATACCTGATAGAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008495.1-808s1c1
Sequence:CCGGGAATTGAATGCAGCTATTGTACTCGAGTACAATAGCTGCATTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008495.1-555s1c1
Sequence:CCGGCAGACTGACACCCATACCTTTCTCGAGAAAGGTATGGGTGTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181401
VALIDATED
TMEM64 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 64
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1967s21c1
Sequence:CCGGCCGCATTCTTATTCGATTATACTCGAGTATAATCGAATAAGAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1252s21c1
Sequence:CCGGTCTGGAGGTGGAATCAATATTCTCGAGAATATTGATTCCACCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1041s21c1
Sequence:CCGGCATCGCAGAACAAAGTCTTAGCTCGAGCTAAGACTTTGTTCTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1185s21c1
Sequence:CCGGTCTGGTTAAAGGCAATCAATTCTCGAGAATTGATTGCCTTTAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1123s21c1
Sequence:CCGGCATCGCGCTCAAGTGGAATTGCTCGAGCAATTCCACTTGAGCGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181401.2-1184s1c1
Sequence:CCGGCTCTGGTTAAAGGCAATCAATCTCGAGATTGATTGCCTTTAACCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181401.2-1048s1c1
Sequence:CCGGGAACAAAGTCTTAGTGGCTATCTCGAGATAGCCACTAAGACTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181401.2-1967s1c1
Sequence:CCGGCCGCATTCTTATTCGATTATACTCGAGTATAATCGAATAAGAATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181401
VALIDATED
TMEM64 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 64
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1967s21c1
Sequence:CCGGCCGCATTCTTATTCGATTATACTCGAGTATAATCGAATAAGAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1252s21c1
Sequence:CCGGTCTGGAGGTGGAATCAATATTCTCGAGAATATTGATTCCACCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1041s21c1
Sequence:CCGGCATCGCAGAACAAAGTCTTAGCTCGAGCTAAGACTTTGTTCTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1185s21c1
Sequence:CCGGTCTGGTTAAAGGCAATCAATTCTCGAGAATTGATTGCCTTTAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1123s21c1
Sequence:CCGGCATCGCGCTCAAGTGGAATTGCTCGAGCAATTCCACTTGAGCGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181401.2-1184s1c1
Sequence:CCGGCTCTGGTTAAAGGCAATCAATCTCGAGATTGATTGCCTTTAACCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181401.2-1048s1c1
Sequence:CCGGGAACAAAGTCTTAGTGGCTATCTCGAGATAGCCACTAAGACTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181401.2-1967s1c1
Sequence:CCGGCCGCATTCTTATTCGATTATACTCGAGTATAATCGAATAAGAATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181401
VALIDATED
TMEM64 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 64
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1967s21c1
Sequence:CCGGCCGCATTCTTATTCGATTATACTCGAGTATAATCGAATAAGAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1252s21c1
Sequence:CCGGTCTGGAGGTGGAATCAATATTCTCGAGAATATTGATTCCACCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1041s21c1
Sequence:CCGGCATCGCAGAACAAAGTCTTAGCTCGAGCTAAGACTTTGTTCTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1185s21c1
Sequence:CCGGTCTGGTTAAAGGCAATCAATTCTCGAGAATTGATTGCCTTTAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181401.2-1123s21c1
Sequence:CCGGCATCGCGCTCAAGTGGAATTGCTCGAGCAATTCCACTTGAGCGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181401.2-1184s1c1
Sequence:CCGGCTCTGGTTAAAGGCAATCAATCTCGAGATTGATTGCCTTTAACCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181401.2-1048s1c1
Sequence:CCGGGAACAAAGTCTTAGTGGCTATCTCGAGATAGCCACTAAGACTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181401.2-1967s1c1
Sequence:CCGGCCGCATTCTTATTCGATTATACTCGAGTATAATCGAATAAGAATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks