EMAIL THIS PAGE TO A FRIEND

TMEM65

transmembrane protein 65

UniProtKB ID: Q6PI78, Q8N5G8, Q8WVK5
Gene ID:
Mouse(74868) transmembrane protein 65
Rat(500874) transmembrane protein 65
Zebrafish(100005403) transmembrane protein 65
chicken(428387) transmembrane protein 65
domestic cat(101090234) transmembrane protein 65
dog(609394) transmembrane protein 65
naked mole-rat(101716317) transmembrane protein 65
domestic guinea pig(100734619) transmembrane protein 65
cow(614243) transmembrane protein 65
sheep(101102911) transmembrane protein 65
147 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175212 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175212 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175212 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_194291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194291 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194291 Rosetta Predictions human pricing
NM_001100995 Rosetta Predictions rat pricing
XM_576273 Rosetta Predictions rat pricing
NM_175212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371419 predicted 1130
2 SASI_Hs01_00147974 predicted 1322
3 SASI_Hs01_00147975 predicted 1344
4 SASI_Hs02_00371420 predicted 905
5 SASI_Hs01_00147977 predicted 1094
6 SASI_Hs01_00147978 predicted 1347
7 SASI_Hs01_00147979 predicted 1022
8 SASI_Hs01_00147980 predicted 956
9 SASI_Hs01_00147981 predicted 1184
10 SASI_Hs02_00371421 predicted 1331
11 SASI_Hs01_00147972 predicted 1191
12 SASI_Hs01_00147973 predicted 1547
13 SASI_Hs01_00147976 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211084 predicted 929
2 SASI_Rn02_00211085 predicted 552
3 SASI_Rn02_00211086 predicted 808
4 SASI_Rn02_00211087 predicted 1082
5 SASI_Rn02_00211088 predicted 809
6 SASI_Rn02_00211089 predicted 573
7 SASI_Rn02_00211090 predicted 1135
8 SASI_Rn02_00211091 predicted 543
9 SASI_Rn02_00211092 predicted 1140
10 SASI_Rn02_00211093 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00124893 predicted 914
2 SASI_Rn01_00124894 predicted 805
3 SASI_Rn01_00124895 predicted 1064
4 SASI_Rn01_00124896 predicted 978
5 SASI_Rn01_00124897 predicted 867
6 SASI_Rn01_00124898 predicted 1122
7 SASI_Rn01_00124899 predicted 557
8 SASI_Rn01_00124900 predicted 1026
9 SASI_Rn01_00124901 predicted 840
10 SASI_Rn01_00124902 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345880 predicted 868
2 SASI_Mm01_00167118 predicted 681
3 SASI_Mm01_00167119 predicted 760
4 SASI_Mm01_00167120 predicted 983
5 SASI_Mm01_00167121 predicted 1000
6 SASI_Mm01_00167122 predicted 761
7 SASI_Mm01_00167123 predicted 1032
8 SASI_Mm01_00167124 predicted 998
9 SASI_Mm01_00167125 predicted 1082
10 SASI_Mm01_00167126 predicted 754
11 SASI_Mm01_00167127 predicted 801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175212
TMEM65 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 65
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175212.2-781s1c1
Sequence:CCGGCATTGCCATCGCACAAGGTAACTCGAGTTACCTTGTGCGATGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175212.2-1763s1c1
Sequence:CCGGGCATCTTGAAAGGTTGCATTTCTCGAGAAATGCAACCTTTCAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200711    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175212.2-1814s1c1
Sequence:CCGGGCCTGATATTAGATTACCTTTCTCGAGAAAGGTAATCTAATATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175212.4-690s21c1
Sequence:CCGGATTGTTGCAGGAACCCAAATTCTCGAGAATTTGGGTTCCTGCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175212.4-937s21c1
Sequence:CCGGTAGGAATGTTCCCGTTGATTTCTCGAGAAATCAACGGGAACATTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175212.4-872s21c1
Sequence:CCGGCATGTGGCAAACACGTGTTAGCTCGAGCTAACACGTGTTTGCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175212.4-1128s21c1
Sequence:CCGGACTATGGAAACACTAACTTATCTCGAGATAAGTTAGTGTTTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175212.4-1004s21c1
Sequence:CCGGATCACCTTAGAACACCTATAACTCGAGTTATAGGTGTTCTAAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175212
TMEM65 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 65
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175212.2-781s1c1
Sequence:CCGGCATTGCCATCGCACAAGGTAACTCGAGTTACCTTGTGCGATGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175212.2-1763s1c1
Sequence:CCGGGCATCTTGAAAGGTTGCATTTCTCGAGAAATGCAACCTTTCAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200711    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175212.2-1814s1c1
Sequence:CCGGGCCTGATATTAGATTACCTTTCTCGAGAAAGGTAATCTAATATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175212.4-690s21c1
Sequence:CCGGATTGTTGCAGGAACCCAAATTCTCGAGAATTTGGGTTCCTGCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175212.4-937s21c1
Sequence:CCGGTAGGAATGTTCCCGTTGATTTCTCGAGAAATCAACGGGAACATTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175212.4-872s21c1
Sequence:CCGGCATGTGGCAAACACGTGTTAGCTCGAGCTAACACGTGTTTGCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175212.4-1128s21c1
Sequence:CCGGACTATGGAAACACTAACTTATCTCGAGATAAGTTAGTGTTTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175212.4-1004s21c1
Sequence:CCGGATCACCTTAGAACACCTATAACTCGAGTTATAGGTGTTCTAAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175212
TMEM65 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 65
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175212.2-781s1c1
Sequence:CCGGCATTGCCATCGCACAAGGTAACTCGAGTTACCTTGTGCGATGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175212.2-1763s1c1
Sequence:CCGGGCATCTTGAAAGGTTGCATTTCTCGAGAAATGCAACCTTTCAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200711    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175212.2-1814s1c1
Sequence:CCGGGCCTGATATTAGATTACCTTTCTCGAGAAAGGTAATCTAATATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175212.4-690s21c1
Sequence:CCGGATTGTTGCAGGAACCCAAATTCTCGAGAATTTGGGTTCCTGCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175212.4-937s21c1
Sequence:CCGGTAGGAATGTTCCCGTTGATTTCTCGAGAAATCAACGGGAACATTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175212.4-872s21c1
Sequence:CCGGCATGTGGCAAACACGTGTTAGCTCGAGCTAACACGTGTTTGCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175212.4-1128s21c1
Sequence:CCGGACTATGGAAACACTAACTTATCTCGAGATAAGTTAGTGTTTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175212.4-1004s21c1
Sequence:CCGGATCACCTTAGAACACCTATAACTCGAGTTATAGGTGTTCTAAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194291
TMEM65 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 65
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194291.1-870s1c1
Sequence:CCGGCCAGGACAGCTGAGATATGTACTCGAGTACATATCTCAGCTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194291.1-1093s1c1
Sequence:CCGGGCCTGTCAATTCCTGATCTCACTCGAGTGAGATCAGGAATTGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194291.1-897s1c1
Sequence:CCGGCACAATGCGATACCTTTCATACTCGAGTATGAAAGGTATCGCATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194291.1-888s1c1
Sequence:CCGGGTATTCATCCACAATGCGATACTCGAGTATCGCATTGTGGATGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194291.1-1923s1c1
Sequence:CCGGCCGTGTATACTAACAAGCGTACTCGAGTACGCTTGTTAGTATACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194291.2-1133s21c1
Sequence:CCGGCATGTGGCAAACACGTCTTAGCTCGAGCTAAGACGTGTTTGCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194291.2-1086s21c1
Sequence:CCGGTCCAGGTTAGGCCTGTCAATTCTCGAGAATTGACAGGCCTAACCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194291.2-2625s21c1
Sequence:CCGGTACTTGTAACAGCGTAATTAACTCGAGTTAATTACGCTGTTACAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194291.2-952s21c1
Sequence:CCGGTTGTTGCTGGAACCCATATTGCTCGAGCAATATGGGTTCCAGCAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194291.2-813s21c1
Sequence:CCGGCTGCACCGCTTCGAGTCTATTCTCGAGAATAGACTCGAAGCGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194291
TMEM65 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 65
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194291.1-870s1c1
Sequence:CCGGCCAGGACAGCTGAGATATGTACTCGAGTACATATCTCAGCTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194291.1-1093s1c1
Sequence:CCGGGCCTGTCAATTCCTGATCTCACTCGAGTGAGATCAGGAATTGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194291.1-897s1c1
Sequence:CCGGCACAATGCGATACCTTTCATACTCGAGTATGAAAGGTATCGCATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194291.1-888s1c1
Sequence:CCGGGTATTCATCCACAATGCGATACTCGAGTATCGCATTGTGGATGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194291.1-1923s1c1
Sequence:CCGGCCGTGTATACTAACAAGCGTACTCGAGTACGCTTGTTAGTATACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194291.2-1133s21c1
Sequence:CCGGCATGTGGCAAACACGTCTTAGCTCGAGCTAAGACGTGTTTGCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194291.2-1086s21c1
Sequence:CCGGTCCAGGTTAGGCCTGTCAATTCTCGAGAATTGACAGGCCTAACCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194291.2-2625s21c1
Sequence:CCGGTACTTGTAACAGCGTAATTAACTCGAGTTAATTACGCTGTTACAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194291.2-952s21c1
Sequence:CCGGTTGTTGCTGGAACCCATATTGCTCGAGCAATATGGGTTCCAGCAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194291.2-813s21c1
Sequence:CCGGCTGCACCGCTTCGAGTCTATTCTCGAGAATAGACTCGAAGCGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194291
TMEM65 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 65
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194291.1-870s1c1
Sequence:CCGGCCAGGACAGCTGAGATATGTACTCGAGTACATATCTCAGCTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194291.1-1093s1c1
Sequence:CCGGGCCTGTCAATTCCTGATCTCACTCGAGTGAGATCAGGAATTGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194291.1-897s1c1
Sequence:CCGGCACAATGCGATACCTTTCATACTCGAGTATGAAAGGTATCGCATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194291.1-888s1c1
Sequence:CCGGGTATTCATCCACAATGCGATACTCGAGTATCGCATTGTGGATGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194291.1-1923s1c1
Sequence:CCGGCCGTGTATACTAACAAGCGTACTCGAGTACGCTTGTTAGTATACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194291.2-1133s21c1
Sequence:CCGGCATGTGGCAAACACGTCTTAGCTCGAGCTAAGACGTGTTTGCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194291.2-1086s21c1
Sequence:CCGGTCCAGGTTAGGCCTGTCAATTCTCGAGAATTGACAGGCCTAACCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194291.2-2625s21c1
Sequence:CCGGTACTTGTAACAGCGTAATTAACTCGAGTTAATTACGCTGTTACAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194291.2-952s21c1
Sequence:CCGGTTGTTGCTGGAACCCATATTGCTCGAGCAATATGGGTTCCAGCAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194291.2-813s21c1
Sequence:CCGGCTGCACCGCTTCGAGTCTATTCTCGAGAATAGACTCGAAGCGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks