EMAIL THIS PAGE TO A FRIEND

TMEM66

transmembrane protein 66

Synonyms: FOAP-7 SARAF XTP3
Gene ID:
Mouse(67887) transmembrane protein 66
Rat(290796) transmembrane protein 66
cow(515461) transmembrane protein 66
sheep(101103782) transmembrane protein 66
domestic guinea pig(100730514) transmembrane protein 66
naked mole-rat(101721110) transmembrane protein 66
chicken(422624) transmembrane protein 66
domestic cat(101089096) transmembrane protein 66
dog(482878) transmembrane protein 66
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016127 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016127 Rosetta Predictions human pricing
NM_001004213 Rosetta Predictions rat pricing
NM_026432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070453 predicted 308
2 SASI_Hs02_00348914 predicted 737
3 SASI_Hs01_00070456 predicted 443
4 SASI_Hs01_00070458 predicted 867
5 SASI_Hs01_00070460 predicted 326
6 SASI_Hs02_00348915 predicted 859
7 SASI_Hs02_00348916 predicted 1266
8 SASI_Hs02_00348917 predicted 575
9 SASI_Hs01_00070454 predicted 683
10 SASI_Hs01_00070455 predicted 533
11 SASI_Hs01_00070457 predicted 561
12 SASI_Hs01_00070459 predicted 553
13 SASI_Hs01_00070461 predicted 1285
14 SASI_Hs01_00070462 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117837 predicted 1027
2 SASI_Rn02_00198198 predicted 365
3 SASI_Rn01_00117838 predicted 1119
4 SASI_Rn01_00117839 predicted 1024
5 SASI_Rn02_00198199 predicted 550
6 SASI_Rn01_00117841 predicted 495
7 SASI_Rn01_00117843 predicted 1129
8 SASI_Rn01_00117844 predicted 1191
9 SASI_Rn01_00117845 predicted 1165
10 SASI_Rn01_00117846 predicted 397
11 SASI_Rn01_00117840 predicted 1154
12 SASI_Rn01_00117842 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027233 predicted 1192
2 SASI_Mm01_00027234 predicted 1236
3 SASI_Mm01_00027235 predicted 409
4 SASI_Mm01_00027236 predicted 408
5 SASI_Mm01_00027238 predicted 714
6 SASI_Mm01_00027239 predicted 562
7 SASI_Mm02_00330250 predicted 294
8 SASI_Mm01_00027240 predicted 1239
9 SASI_Mm01_00027241 predicted 770
10 SASI_Mm01_00027242 predicted 443
11 SASI_Mm01_00027237 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026432
VALIDATED
TMEM66 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 66
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026432.3-563s21c1
Sequence:CCGGGCTTGGAGTACAACTTAGATTCTCGAGAATCTAAGTTGTACTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026432.3-457s21c1
Sequence:CCGGGAATGTAAGACCGACTTGGATCTCGAGATCCAAGTCGGTCTTACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026432.3-1202s21c1
Sequence:CCGGGCAAAGTTTCTGATTTGTCATCTCGAGATGACAAATCAGAAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026432.3-703s21c1
Sequence:CCGGGTTCTCGCCTTTGCGGTTTACCTCGAGGTAAACCGCAAAGGCGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026432.2-432s1c1
Sequence:CCGGGAATGTAAGACCGACTTGGATCTCGAGATCCAAGTCGGTCTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026432.2-536s1c1
Sequence:CCGGCGGCTTGGAGTACAACTTAGACTCGAGTCTAAGTTGTACTCCAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026432.2-538s1c1
Sequence:CCGGGCTTGGAGTACAACTTAGATTCTCGAGAATCTAAGTTGTACTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026432.2-1177s1c1
Sequence:CCGGGCAAAGTTTCTGATTTGTCATCTCGAGATGACAAATCAGAAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026432
VALIDATED
TMEM66 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 66
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026432.3-563s21c1
Sequence:CCGGGCTTGGAGTACAACTTAGATTCTCGAGAATCTAAGTTGTACTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026432.3-457s21c1
Sequence:CCGGGAATGTAAGACCGACTTGGATCTCGAGATCCAAGTCGGTCTTACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026432.3-1202s21c1
Sequence:CCGGGCAAAGTTTCTGATTTGTCATCTCGAGATGACAAATCAGAAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026432.3-703s21c1
Sequence:CCGGGTTCTCGCCTTTGCGGTTTACCTCGAGGTAAACCGCAAAGGCGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026432.2-432s1c1
Sequence:CCGGGAATGTAAGACCGACTTGGATCTCGAGATCCAAGTCGGTCTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026432.2-536s1c1
Sequence:CCGGCGGCTTGGAGTACAACTTAGACTCGAGTCTAAGTTGTACTCCAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026432.2-538s1c1
Sequence:CCGGGCTTGGAGTACAACTTAGATTCTCGAGAATCTAAGTTGTACTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026432.2-1177s1c1
Sequence:CCGGGCAAAGTTTCTGATTTGTCATCTCGAGATGACAAATCAGAAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026432
VALIDATED
TMEM66 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 66
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026432.3-563s21c1
Sequence:CCGGGCTTGGAGTACAACTTAGATTCTCGAGAATCTAAGTTGTACTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026432.3-457s21c1
Sequence:CCGGGAATGTAAGACCGACTTGGATCTCGAGATCCAAGTCGGTCTTACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026432.3-1202s21c1
Sequence:CCGGGCAAAGTTTCTGATTTGTCATCTCGAGATGACAAATCAGAAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026432.3-703s21c1
Sequence:CCGGGTTCTCGCCTTTGCGGTTTACCTCGAGGTAAACCGCAAAGGCGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026432.2-432s1c1
Sequence:CCGGGAATGTAAGACCGACTTGGATCTCGAGATCCAAGTCGGTCTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026432.2-536s1c1
Sequence:CCGGCGGCTTGGAGTACAACTTAGACTCGAGTCTAAGTTGTACTCCAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026432.2-538s1c1
Sequence:CCGGGCTTGGAGTACAACTTAGATTCTCGAGAATCTAAGTTGTACTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026432.2-1177s1c1
Sequence:CCGGGCAAAGTTTCTGATTTGTCATCTCGAGATGACAAATCAGAAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016127
VALIDATED
TMEM66 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 66
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016127.4-480s21c1
Sequence:CCGGCGGACTTAGATATTGCATACACTCGAGTGTATGCAATATCTAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016127.4-736s21c1
Sequence:CCGGGATCGCCTTTGTAGTCTATAACTCGAGTTATAGACTACAAAGGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016127.4-1128s21c1
Sequence:CCGGGCAGCTATTCGGTATGTTCAACTCGAGTTGAACATACCGAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016127.4-1574s21c1
Sequence:CCGGGCTGATGAGTTATTACCTCATCTCGAGATGAGGTAATAACTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016127.4-990s21c1
Sequence:CCGGCTGGTGGAATACTAGGATATTCTCGAGAATATCCTAGTATTCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-1128s1c1
Sequence:CCGGGCAGCTATTCGGTATGTTCAACTCGAGTTGAACATACCGAATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-1574s1c1
Sequence:CCGGGCTGATGAGTTATTACCTCATCTCGAGATGAGGTAATAACTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-736s1c1
Sequence:CCGGGATCGCCTTTGTAGTCTATAACTCGAGTTATAGACTACAAAGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-990s1c1
Sequence:CCGGCTGGTGGAATACTAGGATATTCTCGAGAATATCCTAGTATTCCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-480s1c1
Sequence:CCGGCGGACTTAGATATTGCATACACTCGAGTGTATGCAATATCTAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016127.4-1407s1c1
Sequence:CCGGCAGTGTAACATGCAGATGTATCTCGAGATACATCTGCATGTTACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016127
VALIDATED
TMEM66 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 66
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016127.4-480s21c1
Sequence:CCGGCGGACTTAGATATTGCATACACTCGAGTGTATGCAATATCTAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016127.4-736s21c1
Sequence:CCGGGATCGCCTTTGTAGTCTATAACTCGAGTTATAGACTACAAAGGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016127.4-1128s21c1
Sequence:CCGGGCAGCTATTCGGTATGTTCAACTCGAGTTGAACATACCGAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016127.4-1574s21c1
Sequence:CCGGGCTGATGAGTTATTACCTCATCTCGAGATGAGGTAATAACTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016127.4-990s21c1
Sequence:CCGGCTGGTGGAATACTAGGATATTCTCGAGAATATCCTAGTATTCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-1128s1c1
Sequence:CCGGGCAGCTATTCGGTATGTTCAACTCGAGTTGAACATACCGAATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-1574s1c1
Sequence:CCGGGCTGATGAGTTATTACCTCATCTCGAGATGAGGTAATAACTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-736s1c1
Sequence:CCGGGATCGCCTTTGTAGTCTATAACTCGAGTTATAGACTACAAAGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-990s1c1
Sequence:CCGGCTGGTGGAATACTAGGATATTCTCGAGAATATCCTAGTATTCCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-480s1c1
Sequence:CCGGCGGACTTAGATATTGCATACACTCGAGTGTATGCAATATCTAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016127.4-1407s1c1
Sequence:CCGGCAGTGTAACATGCAGATGTATCTCGAGATACATCTGCATGTTACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016127
VALIDATED
TMEM66 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 66
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016127.4-480s21c1
Sequence:CCGGCGGACTTAGATATTGCATACACTCGAGTGTATGCAATATCTAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016127.4-736s21c1
Sequence:CCGGGATCGCCTTTGTAGTCTATAACTCGAGTTATAGACTACAAAGGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016127.4-1128s21c1
Sequence:CCGGGCAGCTATTCGGTATGTTCAACTCGAGTTGAACATACCGAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016127.4-1574s21c1
Sequence:CCGGGCTGATGAGTTATTACCTCATCTCGAGATGAGGTAATAACTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016127.4-990s21c1
Sequence:CCGGCTGGTGGAATACTAGGATATTCTCGAGAATATCCTAGTATTCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-1128s1c1
Sequence:CCGGGCAGCTATTCGGTATGTTCAACTCGAGTTGAACATACCGAATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-1574s1c1
Sequence:CCGGGCTGATGAGTTATTACCTCATCTCGAGATGAGGTAATAACTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-736s1c1
Sequence:CCGGGATCGCCTTTGTAGTCTATAACTCGAGTTATAGACTACAAAGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-990s1c1
Sequence:CCGGCTGGTGGAATACTAGGATATTCTCGAGAATATCCTAGTATTCCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_016127.4-480s1c1
Sequence:CCGGCGGACTTAGATATTGCATACACTCGAGTGTATGCAATATCTAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016127.4-1407s1c1
Sequence:CCGGCAGTGTAACATGCAGATGTATCTCGAGATACATCTGCATGTTACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks