EMAIL THIS PAGE TO A FRIEND

TMEM67

transmembrane protein 67

Synonyms: JBTS6 MECKELIN MKS3 NPHP11 TNEM67
Gene ID:
Human(91147) Summary: The protein encoded by this gene localizes to the primary cilium and to the plasma membrane. The gene functions in centriole migration to the apical membrane and formation of the primary cilium. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Meckel syndrome type 3 (MKS3) and Joubert syndrome type 6 (JBTS6). [provided by RefSeq, Nov 2008]
Mouse(329795) transmembrane protein 67
Rat(313067) transmembrane protein 67
Zebrafish(572194) transmembrane protein 67
domestic cat(101089077) transmembrane protein 67
Horse(100051660) transmembrane protein 67
dog(487049) transmembrane protein 67
chicken(420224) transmembrane protein 67
naked mole-rat(101723826) transmembrane protein 67
domestic guinea pig(100719473) transmembrane protein 67
cow(506762) transmembrane protein 67
sheep(101110519) transmembrane protein 67
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153704 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153704 Rosetta Predictions human pricing
NM_001107916 Rosetta Predictions rat pricing
NM_177861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367424 predicted 916
2 SASI_Hs01_00237296 predicted 1925
3 SASI_Hs01_00237297 predicted 461
4 SASI_Hs01_00237298 predicted 849
5 SASI_Hs01_00237300 predicted 2153
6 SASI_Hs01_00237301 predicted 680
7 SASI_Hs01_00237302 predicted 1499
8 SASI_Hs01_00237303 predicted 2848
9 SASI_Hs01_00237304 predicted 531
10 SASI_Hs02_00367425 predicted 259
11 SASI_Hs01_00237299 predicted 1090
12 SASI_Hs01_00237305 predicted 2224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233545 predicted 1260
2 SASI_Rn02_00233546 predicted 1100
3 SASI_Rn02_00233547 predicted 2485
4 SASI_Rn02_00233548 predicted 530
5 SASI_Rn02_00233549 predicted 2165
6 SASI_Rn02_00233550 predicted 370
7 SASI_Rn02_00233551 predicted 1609
8 SASI_Rn02_00233552 predicted 1031
9 SASI_Rn02_00233553 predicted 1890
10 SASI_Rn02_00233554 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034129 predicted 633
2 SASI_Mm01_00034130 predicted 851
3 SASI_Mm01_00034131 predicted 2425
4 SASI_Mm02_00348340 predicted 458
5 SASI_Mm01_00034132 predicted 2183
6 SASI_Mm01_00034134 predicted 2163
7 SASI_Mm01_00034136 predicted 1857
8 SASI_Mm01_00034137 predicted 1037
9 SASI_Mm02_00348341 predicted 2649
10 SASI_Mm01_00034138 predicted 2081
11 SASI_Mm01_00034133 predicted 662
12 SASI_Mm01_00034135 predicted 2920
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153704
VALIDATED
TMEM67 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 67
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_153704.3-1235s1c1
Sequence:CCGGGTGCCTGTGTTAAACCTAAATCTCGAGATTTAGGTTTAACACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153704.3-708s1c1
Sequence:CCGGGTTGGGTATATGCCAATCTAACTCGAGTTAGATTGGCATATACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148737    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153704.3-3329s1c1
Sequence:CCGGCTGCCTGAATCTTCTCACATTCTCGAGAATGTGAGAAGATTCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153704.3-3290s1c1
Sequence:CCGGCCATCATTTGTCTCTGTAGATCTCGAGATCTACAGAGACAAATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147047    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153704.3-3011s1c1
Sequence:CCGGCTCAGTATAATCATGGCCAAACTCGAGTTTGGCCATGATTATACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153704.3-2240s1c1
Sequence:CCGGGTCGTGTTCTTTGCTGTCTTTCTCGAGAAAGACAGCAAAGAACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153704.3-551s1c1
Sequence:CCGGGCATGTTCAGAACCTAACATTCTCGAGAATGTTAGGTTCTGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153704.3-1083s1c1
Sequence:CCGGCAAGGCTAAATGCTGCTTATTCTCGAGAATAAGCAGCATTTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-217s21c1
Sequence:CCGGGCGACAACAACCAGTACTTTGCTCGAGCAAAGTACTGGTTGTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-2358s21c1
Sequence:CCGGATTCGACAGTTCGTTGATTTACTCGAGTAAATCAACGAACTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-1456s21c1
Sequence:CCGGTTCGAGTTGCTACTCAAATATCTCGAGATATTTGAGTAGCAACTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153704.5-2828s21c1
Sequence:CCGGTTACAATGATGAAGGTTATTCCTCGAGGAATAACCTTCATCATTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-1210s21c1
Sequence:CCGGTTCCTATCTCTAAGATCTTAACTCGAGTTAAGATCTTAGAGATAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-865s21c1
Sequence:CCGGTTGATGCATGTGGACTATTTCCTCGAGGAAATAGTCCACATGCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153704.5-1232s21c1
Sequence:CCGGTGACTTTCCCACTCCTATATTCTCGAGAATATAGGAGTGGGAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-3246s21c1
Sequence:CCGGTCCCATTGTGTGTAGTATTTACTCGAGTAAATACTACACACAATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153704
VALIDATED
TMEM67 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 67
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_153704.3-1235s1c1
Sequence:CCGGGTGCCTGTGTTAAACCTAAATCTCGAGATTTAGGTTTAACACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153704.3-708s1c1
Sequence:CCGGGTTGGGTATATGCCAATCTAACTCGAGTTAGATTGGCATATACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148737    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153704.3-3329s1c1
Sequence:CCGGCTGCCTGAATCTTCTCACATTCTCGAGAATGTGAGAAGATTCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153704.3-3290s1c1
Sequence:CCGGCCATCATTTGTCTCTGTAGATCTCGAGATCTACAGAGACAAATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147047    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153704.3-3011s1c1
Sequence:CCGGCTCAGTATAATCATGGCCAAACTCGAGTTTGGCCATGATTATACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153704.3-2240s1c1
Sequence:CCGGGTCGTGTTCTTTGCTGTCTTTCTCGAGAAAGACAGCAAAGAACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153704.3-551s1c1
Sequence:CCGGGCATGTTCAGAACCTAACATTCTCGAGAATGTTAGGTTCTGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153704.3-1083s1c1
Sequence:CCGGCAAGGCTAAATGCTGCTTATTCTCGAGAATAAGCAGCATTTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-217s21c1
Sequence:CCGGGCGACAACAACCAGTACTTTGCTCGAGCAAAGTACTGGTTGTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-2358s21c1
Sequence:CCGGATTCGACAGTTCGTTGATTTACTCGAGTAAATCAACGAACTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-1456s21c1
Sequence:CCGGTTCGAGTTGCTACTCAAATATCTCGAGATATTTGAGTAGCAACTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153704.5-2828s21c1
Sequence:CCGGTTACAATGATGAAGGTTATTCCTCGAGGAATAACCTTCATCATTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-1210s21c1
Sequence:CCGGTTCCTATCTCTAAGATCTTAACTCGAGTTAAGATCTTAGAGATAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-865s21c1
Sequence:CCGGTTGATGCATGTGGACTATTTCCTCGAGGAAATAGTCCACATGCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153704.5-1232s21c1
Sequence:CCGGTGACTTTCCCACTCCTATATTCTCGAGAATATAGGAGTGGGAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-3246s21c1
Sequence:CCGGTCCCATTGTGTGTAGTATTTACTCGAGTAAATACTACACACAATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153704
VALIDATED
TMEM67 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 67
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_153704.3-1235s1c1
Sequence:CCGGGTGCCTGTGTTAAACCTAAATCTCGAGATTTAGGTTTAACACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153704.3-708s1c1
Sequence:CCGGGTTGGGTATATGCCAATCTAACTCGAGTTAGATTGGCATATACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148737    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153704.3-3329s1c1
Sequence:CCGGCTGCCTGAATCTTCTCACATTCTCGAGAATGTGAGAAGATTCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153704.3-3290s1c1
Sequence:CCGGCCATCATTTGTCTCTGTAGATCTCGAGATCTACAGAGACAAATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147047    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153704.3-3011s1c1
Sequence:CCGGCTCAGTATAATCATGGCCAAACTCGAGTTTGGCCATGATTATACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153704.3-2240s1c1
Sequence:CCGGGTCGTGTTCTTTGCTGTCTTTCTCGAGAAAGACAGCAAAGAACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153704.3-551s1c1
Sequence:CCGGGCATGTTCAGAACCTAACATTCTCGAGAATGTTAGGTTCTGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153704.3-1083s1c1
Sequence:CCGGCAAGGCTAAATGCTGCTTATTCTCGAGAATAAGCAGCATTTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-217s21c1
Sequence:CCGGGCGACAACAACCAGTACTTTGCTCGAGCAAAGTACTGGTTGTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-2358s21c1
Sequence:CCGGATTCGACAGTTCGTTGATTTACTCGAGTAAATCAACGAACTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-1456s21c1
Sequence:CCGGTTCGAGTTGCTACTCAAATATCTCGAGATATTTGAGTAGCAACTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153704.5-2828s21c1
Sequence:CCGGTTACAATGATGAAGGTTATTCCTCGAGGAATAACCTTCATCATTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-1210s21c1
Sequence:CCGGTTCCTATCTCTAAGATCTTAACTCGAGTTAAGATCTTAGAGATAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-865s21c1
Sequence:CCGGTTGATGCATGTGGACTATTTCCTCGAGGAAATAGTCCACATGCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153704.5-1232s21c1
Sequence:CCGGTGACTTTCCCACTCCTATATTCTCGAGAATATAGGAGTGGGAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_153704.5-3246s21c1
Sequence:CCGGTCCCATTGTGTGTAGTATTTACTCGAGTAAATACTACACACAATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177861
TMEM67 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 67
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177861.2-3011s1c1
Sequence:CCGGCAGAACTTAAGGACTCAGTATCTCGAGATACTGAGTCCTTAAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177861.2-1252s1c1
Sequence:CCGGCCAGTGTTAAACCTAAATCTTCTCGAGAAGATTTAGGTTTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177861.2-539s1c1
Sequence:CCGGGCGAACCAACATTTGTGAATACTCGAGTATTCACAAATGTTGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177861.2-780s1c1
Sequence:CCGGCGTGATGAACATGAACTCTTACTCGAGTAAGAGTTCATGTTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177861.2-251s1c1
Sequence:CCGGCCTGTGTATGTCTACCAGGATCTCGAGATCCTGGTAGACATACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177861
TMEM67 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 67
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177861.2-3011s1c1
Sequence:CCGGCAGAACTTAAGGACTCAGTATCTCGAGATACTGAGTCCTTAAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177861.2-1252s1c1
Sequence:CCGGCCAGTGTTAAACCTAAATCTTCTCGAGAAGATTTAGGTTTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177861.2-539s1c1
Sequence:CCGGGCGAACCAACATTTGTGAATACTCGAGTATTCACAAATGTTGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177861.2-780s1c1
Sequence:CCGGCGTGATGAACATGAACTCTTACTCGAGTAAGAGTTCATGTTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177861.2-251s1c1
Sequence:CCGGCCTGTGTATGTCTACCAGGATCTCGAGATCCTGGTAGACATACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177861
TMEM67 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 67
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177861.2-3011s1c1
Sequence:CCGGCAGAACTTAAGGACTCAGTATCTCGAGATACTGAGTCCTTAAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177861.2-1252s1c1
Sequence:CCGGCCAGTGTTAAACCTAAATCTTCTCGAGAAGATTTAGGTTTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177861.2-539s1c1
Sequence:CCGGGCGAACCAACATTTGTGAATACTCGAGTATTCACAAATGTTGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177861.2-780s1c1
Sequence:CCGGCGTGATGAACATGAACTCTTACTCGAGTAAGAGTTCATGTTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177861.2-251s1c1
Sequence:CCGGCCTGTGTATGTCTACCAGGATCTCGAGATCCTGGTAGACATACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks