EMAIL THIS PAGE TO A FRIEND

TMEM68

transmembrane protein 68

UniProtKB ID: Q96MH6, Q658X6, Q8WUD2
Gene ID:
Mouse(72098) transmembrane protein 68
Rat(312946) transmembrane protein 68
cow(534013) transmembrane protein 68
sheep(101114876) transmembrane protein 68
domestic guinea pig(100713542) transmembrane protein 68
Zebrafish(393464) transmembrane protein 68
chicken(421124) transmembrane protein 68
Horse(100068011) transmembrane protein 68
domestic cat(101096134) transmembrane protein 68
dog(486958) transmembrane protein 68
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152417 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028097 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028097 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028097 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152417 Rosetta Predictions human pricing
NM_001107903 Rosetta Predictions rat pricing
NM_028097 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229115 predicted 870
2 SASI_Hs02_00366136 predicted 660
3 SASI_Hs01_00229117 predicted 216
4 SASI_Hs02_00366137 predicted 614
5 SASI_Hs01_00229118 predicted 909
6 SASI_Hs01_00229119 predicted 561
7 SASI_Hs01_00229121 predicted 858
8 SASI_Hs02_00366138 predicted 686
9 SASI_Hs01_00229122 predicted 231
10 SASI_Hs01_00229124 predicted 991
11 SASI_Hs01_00229116 predicted 416
12 SASI_Hs01_00229120 predicted 966
13 SASI_Hs01_00229123 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233415 predicted 973
2 SASI_Rn02_00233416 predicted 928
3 SASI_Rn02_00233417 predicted 630
4 SASI_Rn02_00233418 predicted 737
5 SASI_Rn02_00233419 predicted 1185
6 SASI_Rn02_00233420 predicted 405
7 SASI_Rn02_00233421 predicted 1222
8 SASI_Rn02_00233422 predicted 1331
9 SASI_Rn02_00233423 predicted 1200
10 SASI_Rn02_00233424 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060046 predicted 673
2 SASI_Mm01_00060047 predicted 1019
3 SASI_Mm01_00060048 predicted 488
4 SASI_Mm01_00060049 predicted 235
5 SASI_Mm01_00060050 predicted 988
6 SASI_Mm01_00060051 predicted 220
7 SASI_Mm01_00060052 predicted 1079
8 SASI_Mm01_00060053 predicted 1160
9 SASI_Mm01_00060054 predicted 616
10 SASI_Mm01_00060055 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152417
TMEM68 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 68
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152417.1-266s21c1
Sequence:CCGGGAGCAGTTGGAGGACTATTTGCTCGAGCAAATAGTCCTCCAACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152417.1-1253s21c1
Sequence:CCGGTTCCTGGATAATGCGTTAAATCTCGAGATTTAACGCATTATCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152417.1-630s21c1
Sequence:CCGGGAGTAGTAGCTGATCACTTTGCTCGAGCAAAGTGATCAGCTACTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152417.1-206s21c1
Sequence:CCGGCAGGATTCTGTGCCCTATATGCTCGAGCATATAGGGCACAGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152417.1-1025s21c1
Sequence:CCGGGTAGGTCCTATAATTAGTATTCTCGAGAATACTAATTATAGGACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152417.1-906s1c1
Sequence:CCGGCAGGAAACATTATGAGTGCTTCTCGAGAAGCACTCATAATGTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152417.1-768s1c1
Sequence:CCGGGAGTTCGAGAAGCCCTAATTACTCGAGTAATTAGGGCTTCTCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152417.1-779s1c1
Sequence:CCGGGCCCTAATTAGTGATGAAACTCTCGAGAGTTTCATCACTAATTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152417.1-919s1c1
Sequence:CCGGGAGTGCTTTGTTAGAACGTTTCTCGAGAAACGTTCTAACAAAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152417.1-2078s1c1
Sequence:CCGGCCAGCCTGAATGATGAATTTACTCGAGTAAATTCATCATTCAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152417
TMEM68 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 68
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152417.1-266s21c1
Sequence:CCGGGAGCAGTTGGAGGACTATTTGCTCGAGCAAATAGTCCTCCAACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152417.1-1253s21c1
Sequence:CCGGTTCCTGGATAATGCGTTAAATCTCGAGATTTAACGCATTATCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152417.1-630s21c1
Sequence:CCGGGAGTAGTAGCTGATCACTTTGCTCGAGCAAAGTGATCAGCTACTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152417.1-206s21c1
Sequence:CCGGCAGGATTCTGTGCCCTATATGCTCGAGCATATAGGGCACAGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152417.1-1025s21c1
Sequence:CCGGGTAGGTCCTATAATTAGTATTCTCGAGAATACTAATTATAGGACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152417.1-906s1c1
Sequence:CCGGCAGGAAACATTATGAGTGCTTCTCGAGAAGCACTCATAATGTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152417.1-768s1c1
Sequence:CCGGGAGTTCGAGAAGCCCTAATTACTCGAGTAATTAGGGCTTCTCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152417.1-779s1c1
Sequence:CCGGGCCCTAATTAGTGATGAAACTCTCGAGAGTTTCATCACTAATTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152417.1-919s1c1
Sequence:CCGGGAGTGCTTTGTTAGAACGTTTCTCGAGAAACGTTCTAACAAAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152417.1-2078s1c1
Sequence:CCGGCCAGCCTGAATGATGAATTTACTCGAGTAAATTCATCATTCAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152417
TMEM68 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 68
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152417.1-266s21c1
Sequence:CCGGGAGCAGTTGGAGGACTATTTGCTCGAGCAAATAGTCCTCCAACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152417.1-1253s21c1
Sequence:CCGGTTCCTGGATAATGCGTTAAATCTCGAGATTTAACGCATTATCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152417.1-630s21c1
Sequence:CCGGGAGTAGTAGCTGATCACTTTGCTCGAGCAAAGTGATCAGCTACTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152417.1-206s21c1
Sequence:CCGGCAGGATTCTGTGCCCTATATGCTCGAGCATATAGGGCACAGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152417.1-1025s21c1
Sequence:CCGGGTAGGTCCTATAATTAGTATTCTCGAGAATACTAATTATAGGACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152417.1-906s1c1
Sequence:CCGGCAGGAAACATTATGAGTGCTTCTCGAGAAGCACTCATAATGTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152417.1-768s1c1
Sequence:CCGGGAGTTCGAGAAGCCCTAATTACTCGAGTAATTAGGGCTTCTCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152417.1-779s1c1
Sequence:CCGGGCCCTAATTAGTGATGAAACTCTCGAGAGTTTCATCACTAATTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152417.1-919s1c1
Sequence:CCGGGAGTGCTTTGTTAGAACGTTTCTCGAGAAACGTTCTAACAAAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152417.1-2078s1c1
Sequence:CCGGCCAGCCTGAATGATGAATTTACTCGAGTAAATTCATCATTCAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028097
VALIDATED
TMEM68 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 68
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028097.3-2085s21c1
Sequence:CCGGGCAGCCAGTAACGTGGTTATTCTCGAGAATAACCACGTTACTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028097.3-955s21c1
Sequence:CCGGCCGCTATCCATTTGCTCCAATCTCGAGATTGGAGCAAATGGATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028097.3-1164s21c1
Sequence:CCGGCTCATTAGCAGATAGCTTAATCTCGAGATTAAGCTATCTGCTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028097.3-1010s21c1
Sequence:CCGGTTAGGTGATCCCATACCATATCTCGAGATATGGTATGGGATCACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028097.3-492s21c1
Sequence:CCGGCGGCTGTTTGGCATGGTTATGCTCGAGCATAACCATGCCAAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028097.2-2085s1c1
Sequence:CCGGGCAGCCAGTAACGTGGTTATTCTCGAGAATAACCACGTTACTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028097.2-955s1c1
Sequence:CCGGCCGCTATCCATTTGCTCCAATCTCGAGATTGGAGCAAATGGATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028097.2-226s1c1
Sequence:CCGGGCCCTATGTGACCTGTATGATCTCGAGATCATACAGGTCACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028097.2-864s1c1
Sequence:CCGGTGCCCATTATTCCTATGTTTACTCGAGTAAACATAGGAATAATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028097.2-391s1c1
Sequence:CCGGCCTCCATATCTACAAGAGGAACTCGAGTTCCTCTTGTAGATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028097
VALIDATED
TMEM68 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 68
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028097.3-2085s21c1
Sequence:CCGGGCAGCCAGTAACGTGGTTATTCTCGAGAATAACCACGTTACTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028097.3-955s21c1
Sequence:CCGGCCGCTATCCATTTGCTCCAATCTCGAGATTGGAGCAAATGGATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028097.3-1164s21c1
Sequence:CCGGCTCATTAGCAGATAGCTTAATCTCGAGATTAAGCTATCTGCTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028097.3-1010s21c1
Sequence:CCGGTTAGGTGATCCCATACCATATCTCGAGATATGGTATGGGATCACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028097.3-492s21c1
Sequence:CCGGCGGCTGTTTGGCATGGTTATGCTCGAGCATAACCATGCCAAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028097.2-2085s1c1
Sequence:CCGGGCAGCCAGTAACGTGGTTATTCTCGAGAATAACCACGTTACTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028097.2-955s1c1
Sequence:CCGGCCGCTATCCATTTGCTCCAATCTCGAGATTGGAGCAAATGGATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028097.2-226s1c1
Sequence:CCGGGCCCTATGTGACCTGTATGATCTCGAGATCATACAGGTCACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028097.2-864s1c1
Sequence:CCGGTGCCCATTATTCCTATGTTTACTCGAGTAAACATAGGAATAATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028097.2-391s1c1
Sequence:CCGGCCTCCATATCTACAAGAGGAACTCGAGTTCCTCTTGTAGATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028097
VALIDATED
TMEM68 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 68
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028097.3-2085s21c1
Sequence:CCGGGCAGCCAGTAACGTGGTTATTCTCGAGAATAACCACGTTACTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028097.3-955s21c1
Sequence:CCGGCCGCTATCCATTTGCTCCAATCTCGAGATTGGAGCAAATGGATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028097.3-1164s21c1
Sequence:CCGGCTCATTAGCAGATAGCTTAATCTCGAGATTAAGCTATCTGCTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028097.3-1010s21c1
Sequence:CCGGTTAGGTGATCCCATACCATATCTCGAGATATGGTATGGGATCACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028097.3-492s21c1
Sequence:CCGGCGGCTGTTTGGCATGGTTATGCTCGAGCATAACCATGCCAAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028097.2-2085s1c1
Sequence:CCGGGCAGCCAGTAACGTGGTTATTCTCGAGAATAACCACGTTACTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028097.2-955s1c1
Sequence:CCGGCCGCTATCCATTTGCTCCAATCTCGAGATTGGAGCAAATGGATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028097.2-226s1c1
Sequence:CCGGGCCCTATGTGACCTGTATGATCTCGAGATCATACAGGTCACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028097.2-864s1c1
Sequence:CCGGTGCCCATTATTCCTATGTTTACTCGAGTAAACATAGGAATAATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028097.2-391s1c1
Sequence:CCGGCCTCCATATCTACAAGAGGAACTCGAGTTCCTCTTGTAGATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks