EMAIL THIS PAGE TO A FRIEND

TMEM69

transmembrane protein 69

Synonyms: C1orf154 RP11-767N6.4
UniProtKB ID: Q5SWH9, Q3SWW5, Q7Z2G0, Q9P0P9
Gene ID:
Mouse(230657) transmembrane protein 69
Rat(619582) transmembrane protein 69
Zebrafish(557512) transmembrane protein 69
chicken(424604) transmembrane protein 69
dog(100684315) transmembrane protein 69
Horse(100065125) transmembrane protein 69
domestic cat(101092529) transmembrane protein 69
domestic guinea pig(100722213) transmembrane protein 69
naked mole-rat(101714188) transmembrane protein 69
cow(785268) transmembrane protein 69
sheep(101122991) transmembrane protein 69
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV47258 Anti-TMEM69 antibody produced in rabbit affinity isolated antibody horse, rat, human, zebrafish, guinea pig, rabbit, mouse
immunohistochemistry, western blot pricing
HPA026993 Anti-TMEM69 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016486 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU078161 MISSION® esiRNA esiRNA targeting mouse Tmem69 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016486 Rosetta Predictions human pricing
NM_001035001 Rosetta Predictions rat pricing
NM_177670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075732 predicted 653
2 SASI_Hs01_00075733 predicted 443
3 SASI_Hs01_00075735 predicted 435
4 SASI_Hs01_00075736 predicted 753
5 SASI_Hs01_00075737 predicted 828
6 SASI_Hs02_00349545 predicted 289
7 SASI_Hs01_00075738 predicted 739
8 SASI_Hs01_00075739 predicted 465
9 SASI_Hs01_00075740 predicted 730
10 SASI_Hs02_00349546 predicted 264
11 SASI_Hs01_00075734 predicted 334
12 SASI_Hs01_00075741 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204167 predicted 605
2 SASI_Rn01_00036120 predicted 763
3 SASI_Rn01_00036121 predicted 754
4 SASI_Rn01_00036122 predicted 684
5 SASI_Rn01_00036123 predicted 702
6 SASI_Rn01_00036124 predicted 859
7 SASI_Rn01_00036125 predicted 533
8 SASI_Rn01_00036126 predicted 610
9 SASI_Rn01_00036128 predicted 902
10 SASI_Rn01_00036129 predicted 218
11 SASI_Rn01_00036127 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347971 predicted 500
2 SASI_Mm02_00347972 predicted 358
3 SASI_Mm02_00347973 predicted 618
4 SASI_Mm02_00347974 predicted 532
5 SASI_Mm02_00347975 predicted 621
6 SASI_Mm02_00347976 predicted 707
7 SASI_Mm02_00347977 predicted 386
8 SASI_Mm02_00347978 predicted 242
9 SASI_Mm02_00347979 predicted 244
10 SASI_Mm02_00347980 predicted 413
11 SASI_Mm01_00157797 predicted 522
12 SASI_Mm01_00157798 predicted 712
13 SASI_Mm01_00157799 predicted 727
14 SASI_Mm01_00157800 predicted 643
15 SASI_Mm01_00157801 predicted 840
16 SASI_Mm01_00157802 predicted 790
17 SASI_Mm01_00157803 predicted 802
18 SASI_Mm01_00157804 predicted 867
19 SASI_Mm01_00157805 predicted 234
20 SASI_Mm01_00157806 predicted 342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016486
VALIDATED
TMEM69 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 69
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016486.2-638s1c1
Sequence:CCGGGCCAAACCAGACTACCTTAATCTCGAGATTAAGGTAGTCTGGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-725s1c1
Sequence:CCGGGAAGCCATAGTCACAGTAATACTCGAGTATTACTGTGACTATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-456s1c1
Sequence:CCGGCAAAGCCAGCATTATGTGTAACTCGAGTTACACATAATGCTGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-351s1c1
Sequence:CCGGGCAAGACACAGTGCTATCATACTCGAGTATGATAGCACTGTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-639s1c1
Sequence:CCGGCCAAACCAGACTACCTTAATTCTCGAGAATTAAGGTAGTCTGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-815s1c1
Sequence:CCGGCTGAGGATAGTAGTCACTTTACTCGAGTAAAGTGACTACTATCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016486.3-372s21c1
Sequence:CCGGGCAAGACACAGTGCTATCATACTCGAGTATGATAGCACTGTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_016486.3-836s21c1
Sequence:CCGGCTGAGGATAGTAGTCACTTTACTCGAGTAAAGTGACTACTATCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016486.3-660s21c1
Sequence:CCGGCCAAACCAGACTACCTTAATTCTCGAGAATTAAGGTAGTCTGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016486.3-1305s21c1
Sequence:CCGGTTGTTACTTCATGGTAATTACCTCGAGGTAATTACCATGAAGTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016486.3-746s21c1
Sequence:CCGGGAAGCCATAGTCACAGTAATACTCGAGTATTACTGTGACTATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016486
VALIDATED
TMEM69 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 69
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016486.2-638s1c1
Sequence:CCGGGCCAAACCAGACTACCTTAATCTCGAGATTAAGGTAGTCTGGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-725s1c1
Sequence:CCGGGAAGCCATAGTCACAGTAATACTCGAGTATTACTGTGACTATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-456s1c1
Sequence:CCGGCAAAGCCAGCATTATGTGTAACTCGAGTTACACATAATGCTGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-351s1c1
Sequence:CCGGGCAAGACACAGTGCTATCATACTCGAGTATGATAGCACTGTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-639s1c1
Sequence:CCGGCCAAACCAGACTACCTTAATTCTCGAGAATTAAGGTAGTCTGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-815s1c1
Sequence:CCGGCTGAGGATAGTAGTCACTTTACTCGAGTAAAGTGACTACTATCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016486.3-372s21c1
Sequence:CCGGGCAAGACACAGTGCTATCATACTCGAGTATGATAGCACTGTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_016486.3-836s21c1
Sequence:CCGGCTGAGGATAGTAGTCACTTTACTCGAGTAAAGTGACTACTATCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016486.3-660s21c1
Sequence:CCGGCCAAACCAGACTACCTTAATTCTCGAGAATTAAGGTAGTCTGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016486.3-1305s21c1
Sequence:CCGGTTGTTACTTCATGGTAATTACCTCGAGGTAATTACCATGAAGTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016486.3-746s21c1
Sequence:CCGGGAAGCCATAGTCACAGTAATACTCGAGTATTACTGTGACTATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016486
VALIDATED
TMEM69 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 69
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016486.2-638s1c1
Sequence:CCGGGCCAAACCAGACTACCTTAATCTCGAGATTAAGGTAGTCTGGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-725s1c1
Sequence:CCGGGAAGCCATAGTCACAGTAATACTCGAGTATTACTGTGACTATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-456s1c1
Sequence:CCGGCAAAGCCAGCATTATGTGTAACTCGAGTTACACATAATGCTGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-351s1c1
Sequence:CCGGGCAAGACACAGTGCTATCATACTCGAGTATGATAGCACTGTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-639s1c1
Sequence:CCGGCCAAACCAGACTACCTTAATTCTCGAGAATTAAGGTAGTCTGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016486.2-815s1c1
Sequence:CCGGCTGAGGATAGTAGTCACTTTACTCGAGTAAAGTGACTACTATCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016486.3-372s21c1
Sequence:CCGGGCAAGACACAGTGCTATCATACTCGAGTATGATAGCACTGTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_016486.3-836s21c1
Sequence:CCGGCTGAGGATAGTAGTCACTTTACTCGAGTAAAGTGACTACTATCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016486.3-660s21c1
Sequence:CCGGCCAAACCAGACTACCTTAATTCTCGAGAATTAAGGTAGTCTGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016486.3-1305s21c1
Sequence:CCGGTTGTTACTTCATGGTAATTACCTCGAGGTAATTACCATGAAGTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016486.3-746s21c1
Sequence:CCGGGAAGCCATAGTCACAGTAATACTCGAGTATTACTGTGACTATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177670
VALIDATED
TMEM69 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 69
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177670.2-526s1c1
Sequence:CCGGGCTTTCACTCAGATGGCTTATCTCGAGATAAGCCATCTGAGTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177670.2-1059s1c1
Sequence:CCGGCCTTGATGATAATGAACTGAACTCGAGTTCAGTTCATTATCATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177670.4-653s1c1
Sequence:CCGGCTAGCAGTATGAGTCCTATTCCTCGAGGAATAGGACTCATACTGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177670.4-1224s21c1
Sequence:CCGGTATCTAGGCTGGGAGCTAAACCTCGAGGTTTAGCTCCCAGCCTAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177670.4-835s21c1
Sequence:CCGGATCTCATTTGTAGTCACTTTACTCGAGTAAAGTGACTACAAATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177670.4-653s21c1
Sequence:CCGGCTAGCAGTATGAGTCCTATTCCTCGAGGAATAGGACTCATACTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177670.4-884s21c1
Sequence:CCGGGGCCCAAGAGACCCGATTAAACTCGAGTTTAATCGGGTCTCTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177670.4-362s21c1
Sequence:CCGGATGTGTCACCATGCAACTTTACTCGAGTAAAGTTGCATGGTGACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177670
VALIDATED
TMEM69 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 69
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177670.2-526s1c1
Sequence:CCGGGCTTTCACTCAGATGGCTTATCTCGAGATAAGCCATCTGAGTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177670.2-1059s1c1
Sequence:CCGGCCTTGATGATAATGAACTGAACTCGAGTTCAGTTCATTATCATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177670.4-653s1c1
Sequence:CCGGCTAGCAGTATGAGTCCTATTCCTCGAGGAATAGGACTCATACTGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177670.4-1224s21c1
Sequence:CCGGTATCTAGGCTGGGAGCTAAACCTCGAGGTTTAGCTCCCAGCCTAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177670.4-835s21c1
Sequence:CCGGATCTCATTTGTAGTCACTTTACTCGAGTAAAGTGACTACAAATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177670.4-653s21c1
Sequence:CCGGCTAGCAGTATGAGTCCTATTCCTCGAGGAATAGGACTCATACTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177670.4-884s21c1
Sequence:CCGGGGCCCAAGAGACCCGATTAAACTCGAGTTTAATCGGGTCTCTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177670.4-362s21c1
Sequence:CCGGATGTGTCACCATGCAACTTTACTCGAGTAAAGTTGCATGGTGACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177670
VALIDATED
TMEM69 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 69
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177670.2-526s1c1
Sequence:CCGGGCTTTCACTCAGATGGCTTATCTCGAGATAAGCCATCTGAGTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177670.2-1059s1c1
Sequence:CCGGCCTTGATGATAATGAACTGAACTCGAGTTCAGTTCATTATCATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177670.4-653s1c1
Sequence:CCGGCTAGCAGTATGAGTCCTATTCCTCGAGGAATAGGACTCATACTGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177670.4-1224s21c1
Sequence:CCGGTATCTAGGCTGGGAGCTAAACCTCGAGGTTTAGCTCCCAGCCTAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177670.4-835s21c1
Sequence:CCGGATCTCATTTGTAGTCACTTTACTCGAGTAAAGTGACTACAAATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177670.4-653s21c1
Sequence:CCGGCTAGCAGTATGAGTCCTATTCCTCGAGGAATAGGACTCATACTGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177670.4-884s21c1
Sequence:CCGGGGCCCAAGAGACCCGATTAAACTCGAGTTTAATCGGGTCTCTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177670.4-362s21c1
Sequence:CCGGATGTGTCACCATGCAACTTTACTCGAGTAAAGTTGCATGGTGACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks