EMAIL THIS PAGE TO A FRIEND

TMEM70

transmembrane protein 70

Synonyms: MC5DN2
UniProtKB ID: Q9BUB7, Q9NWY5
Gene ID:
Human(54968) Summary: This gene likely encodes a mitochondrial membrane protein. The encoded protein may play a role in biogenesis of mitochondrial ATP synthase. Mutations in this gene have been associated with neonatal mitochondrial encephalocardiomyopathy due to ATP synthase deficiency. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
Mouse(70397) transmembrane protein 70
Rat(500384) transmembrane protein 70
cow(613774) transmembrane protein 70
sheep(101116739) transmembrane protein 70
naked mole-rat(101723313) transmembrane protein 70
domestic guinea pig(100729424) transmembrane protein 70
Zebrafish(100002535) transmembrane protein 70
chicken(420188) transmembrane protein 70
domestic cat(101100616) transmembrane protein 70
dog(477915) transmembrane protein 70
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017866 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040613 Rosetta Predictions human pricing
NM_017866 Rosetta Predictions human pricing
NM_001109258 Rosetta Predictions rat pricing
NM_026392 Rosetta Predictions mouse pricing
NM_027415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224213 predicted 903
2 SASI_Hs01_00224214 predicted 872
3 SASI_Hs01_00224215 predicted 784
4 SASI_Hs01_00224217 predicted 849
5 SASI_Hs02_00309008 predicted 862
6 SASI_Hs01_00224218 predicted 875
7 SASI_Hs01_00224219 predicted 621
8 SASI_Hs01_00224220 predicted 670
9 SASI_Hs02_00309009 predicted 692
10 SASI_Hs01_00224221 predicted 745
11 SASI_Hs01_00224216 predicted 671
12 SASI_Hs01_00224222 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181743 predicted 1119
2 SASI_Hs01_00181744 predicted 885
3 SASI_Hs01_00181745 predicted 857
4 SASI_Hs01_00181747 predicted 664
5 SASI_Hs02_00350784 predicted 1078
6 SASI_Hs01_00181748 predicted 827
7 SASI_Hs01_00181749 predicted 732
8 SASI_Hs01_00181751 predicted 867
9 SASI_Hs02_00350785 predicted 1098
10 SASI_Hs02_00350786 predicted 1149
11 SASI_Hs01_00181742 predicted 1001
12 SASI_Hs01_00181746 predicted 1104
13 SASI_Hs01_00181750 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246644 predicted 712
2 SASI_Rn02_00246645 predicted 419
3 SASI_Rn02_00246646 predicted 626
4 SASI_Rn02_00246647 predicted 769
5 SASI_Rn02_00246648 predicted 589
6 SASI_Rn02_00246649 predicted 964
7 SASI_Rn02_00246650 predicted 677
8 SASI_Rn02_00246651 predicted 613
9 SASI_Rn02_00246652 predicted 868
10 SASI_Rn02_00246653 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330155 predicted 607
2 SASI_Mm02_00330156 predicted 595
3 SASI_Mm02_00330157 predicted 612
4 SASI_Mm02_00330158 predicted 1290
5 SASI_Mm02_00330159 predicted 1305
6 SASI_Mm02_00330160 predicted 679
7 SASI_Mm02_00330161 predicted 626
8 SASI_Mm02_00330162 predicted 688
9 SASI_Mm02_00330163 predicted 636
10 SASI_Mm02_00330164 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167420 predicted 597
2 SASI_Mm01_00167422 predicted 587
3 SASI_Mm02_00332154 predicted 613
4 SASI_Mm02_00332155 predicted 1285
5 SASI_Mm01_00167427 predicted 1296
6 SASI_Mm01_00167428 predicted 675
7 SASI_Mm02_00332156 predicted 621
8 SASI_Mm02_00332157 predicted 683
9 SASI_Mm02_00332158 predicted 638
10 SASI_Mm02_00332159 predicted 1284
11 SASI_Mm01_00167421 predicted 394
12 SASI_Mm01_00167423 predicted 286
13 SASI_Mm01_00167424 predicted 378
14 SASI_Mm01_00167425 predicted 1266
15 SASI_Mm01_00167426 predicted 279
16 SASI_Mm01_00167429 predicted 1206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017866
VALIDATED
TMEM70 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 70
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017866.4-644s21c1
Sequence:CCGGCTATGCTTGCAGAAACGAGTACTCGAGTACTCGTTTCTGCAAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017866.4-607s21c1
Sequence:CCGGGCCACAACAGACACTTATAAACTCGAGTTTATAAGTGTCTGTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017866.4-429s21c1
Sequence:CCGGGAGTCTGATTGGCCTTACATTCTCGAGAATGTAAGGCCAATCAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017866.4-836s21c1
Sequence:CCGGCCAGTGAAGAGAAACGGCATACTCGAGTATGCCGTTTCTCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-631s1c1
Sequence:CCGGCTATGCTTGCAGAAACGAGTACTCGAGTACTCGTTTCTGCAAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-416s1c1
Sequence:CCGGGAGTCTGATTGGCCTTACATTCTCGAGAATGTAAGGCCAATCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-823s1c1
Sequence:CCGGCCAGTGAAGAGAAACGGCATACTCGAGTATGCCGTTTCTCTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-594s1c1
Sequence:CCGGGCCACAACAGACACTTATAAACTCGAGTTTATAAGTGTCTGTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-1900s1c1
Sequence:CCGGCGGGAAATGGTAAGTAGTGTTCTCGAGAACACTACTTACCATTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017866
VALIDATED
TMEM70 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 70
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017866.4-644s21c1
Sequence:CCGGCTATGCTTGCAGAAACGAGTACTCGAGTACTCGTTTCTGCAAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017866.4-607s21c1
Sequence:CCGGGCCACAACAGACACTTATAAACTCGAGTTTATAAGTGTCTGTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017866.4-429s21c1
Sequence:CCGGGAGTCTGATTGGCCTTACATTCTCGAGAATGTAAGGCCAATCAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017866.4-836s21c1
Sequence:CCGGCCAGTGAAGAGAAACGGCATACTCGAGTATGCCGTTTCTCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-631s1c1
Sequence:CCGGCTATGCTTGCAGAAACGAGTACTCGAGTACTCGTTTCTGCAAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-416s1c1
Sequence:CCGGGAGTCTGATTGGCCTTACATTCTCGAGAATGTAAGGCCAATCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-823s1c1
Sequence:CCGGCCAGTGAAGAGAAACGGCATACTCGAGTATGCCGTTTCTCTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-594s1c1
Sequence:CCGGGCCACAACAGACACTTATAAACTCGAGTTTATAAGTGTCTGTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-1900s1c1
Sequence:CCGGCGGGAAATGGTAAGTAGTGTTCTCGAGAACACTACTTACCATTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017866
VALIDATED
TMEM70 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 70
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017866.4-644s21c1
Sequence:CCGGCTATGCTTGCAGAAACGAGTACTCGAGTACTCGTTTCTGCAAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017866.4-607s21c1
Sequence:CCGGGCCACAACAGACACTTATAAACTCGAGTTTATAAGTGTCTGTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017866.4-429s21c1
Sequence:CCGGGAGTCTGATTGGCCTTACATTCTCGAGAATGTAAGGCCAATCAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017866.4-836s21c1
Sequence:CCGGCCAGTGAAGAGAAACGGCATACTCGAGTATGCCGTTTCTCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-631s1c1
Sequence:CCGGCTATGCTTGCAGAAACGAGTACTCGAGTACTCGTTTCTGCAAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-416s1c1
Sequence:CCGGGAGTCTGATTGGCCTTACATTCTCGAGAATGTAAGGCCAATCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-823s1c1
Sequence:CCGGCCAGTGAAGAGAAACGGCATACTCGAGTATGCCGTTTCTCTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-594s1c1
Sequence:CCGGGCCACAACAGACACTTATAAACTCGAGTTTATAAGTGTCTGTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017866.3-1900s1c1
Sequence:CCGGCGGGAAATGGTAAGTAGTGTTCTCGAGAACACTACTTACCATTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027415
VALIDATED
TMEM70 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 70
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027415.2-703s21c1
Sequence:CCGGATTCCAGAGAGCGCACATATACTCGAGTATATGTGCGCTCTCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027415.2-348s1c1
Sequence:CCGGCTTCCATACACAAGTTGATAACTCGAGTTATCAACTTGTGTATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027415.2-593s21c1
Sequence:CCGGGCTATGTCATTCGGTTGTATCCTCGAGGATACAACCGAATGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027415.2-401s21c1
Sequence:CCGGACCTGGCCCGAACGATATTTGCTCGAGCAAATATCGTTCGGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027415.2-778s21c1
Sequence:CCGGTTAAACCCTGAAGACTATAACCTCGAGGTTATAGTCTTCAGGGTTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027415.2-1290s21c1
Sequence:CCGGTCATGAATATTCTGGTATATGCTCGAGCATATACCAGAATATTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027415.1-1076s1c1
Sequence:CCGGCGAGGTAGGAAGATTAGAAATCTCGAGATTTCTAATCTTCCTACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027415
VALIDATED
TMEM70 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 70
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027415.2-703s21c1
Sequence:CCGGATTCCAGAGAGCGCACATATACTCGAGTATATGTGCGCTCTCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027415.2-348s1c1
Sequence:CCGGCTTCCATACACAAGTTGATAACTCGAGTTATCAACTTGTGTATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027415.2-593s21c1
Sequence:CCGGGCTATGTCATTCGGTTGTATCCTCGAGGATACAACCGAATGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027415.2-401s21c1
Sequence:CCGGACCTGGCCCGAACGATATTTGCTCGAGCAAATATCGTTCGGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027415.2-778s21c1
Sequence:CCGGTTAAACCCTGAAGACTATAACCTCGAGGTTATAGTCTTCAGGGTTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027415.2-1290s21c1
Sequence:CCGGTCATGAATATTCTGGTATATGCTCGAGCATATACCAGAATATTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027415.1-1076s1c1
Sequence:CCGGCGAGGTAGGAAGATTAGAAATCTCGAGATTTCTAATCTTCCTACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027415
VALIDATED
TMEM70 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 70
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027415.2-703s21c1
Sequence:CCGGATTCCAGAGAGCGCACATATACTCGAGTATATGTGCGCTCTCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027415.2-348s1c1
Sequence:CCGGCTTCCATACACAAGTTGATAACTCGAGTTATCAACTTGTGTATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027415.2-593s21c1
Sequence:CCGGGCTATGTCATTCGGTTGTATCCTCGAGGATACAACCGAATGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027415.2-401s21c1
Sequence:CCGGACCTGGCCCGAACGATATTTGCTCGAGCAAATATCGTTCGGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027415.2-778s21c1
Sequence:CCGGTTAAACCCTGAAGACTATAACCTCGAGGTTATAGTCTTCAGGGTTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027415.2-1290s21c1
Sequence:CCGGTCATGAATATTCTGGTATATGCTCGAGCATATACCAGAATATTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027415.1-1076s1c1
Sequence:CCGGCGAGGTAGGAAGATTAGAAATCTCGAGATTTCTAATCTTCCTACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks