EMAIL THIS PAGE TO A FRIEND

TMEM71

transmembrane protein 71

UniProtKB ID: Q6P5X7, Q3KRC2, Q8WVZ4, Q96LX9
Gene ID:
Mouse(213068) transmembrane protein 71
Rat(690657) transmembrane protein 71
chicken(101664737) transmembrane protein 71
domestic cat(101093748) transmembrane protein 71
dog(610068) transmembrane protein 71
chicken(101749956) transmembrane protein 71
naked mole-rat(101724366) transmembrane protein 71
cow(613491) transmembrane protein 71
sheep(101102316) transmembrane protein 71
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144649 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144649 Rosetta Predictions human pricing
XM_001075116 Rosetta Predictions rat pricing
NM_172514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119557 predicted 495
2 SASI_Hs01_00119559 predicted 245
3 SASI_Hs01_00119560 predicted 833
4 SASI_Hs01_00119561 predicted 352
5 SASI_Hs02_00364517 predicted 739
6 SASI_Hs02_00364518 predicted 735
7 SASI_Hs02_00364519 predicted 443
8 SASI_Hs01_00119563 predicted 239
9 SASI_Hs01_00119564 predicted 771
10 SASI_Hs01_00119565 predicted 352
11 SASI_Hs01_00119558 predicted 254
12 SASI_Hs01_00119562 predicted 567
13 SASI_Hs01_00119566 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348521 predicted 769
2 SASI_Rn02_00348522 predicted 442
3 SASI_Rn02_00348523 predicted 328
4 SASI_Rn02_00348524 predicted 309
5 SASI_Rn02_00348525 predicted 345
6 SASI_Rn02_00348526 predicted 784
7 SASI_Rn02_00348527 predicted 492
8 SASI_Rn02_00348528 predicted 692
9 SASI_Rn02_00348529 predicted 566
10 SASI_Rn02_00348530 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159637 predicted 1097
2 SASI_Mm01_00159638 predicted 989
3 SASI_Mm01_00159639 predicted 528
4 SASI_Mm01_00159640 predicted 1081
5 SASI_Mm01_00159641 predicted 886
6 SASI_Mm01_00159642 predicted 1115
7 SASI_Mm01_00159643 predicted 1056
8 SASI_Mm01_00159644 predicted 1249
9 SASI_Mm01_00159645 predicted 654
10 SASI_Mm01_00159646 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172514
VALIDATED
TMEM71 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 71
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172514.1-393s1c1
Sequence:CCGGCAGTAGCAAATGACTCCAGGTCTCGAGACCTGGAGTCATTTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172514.1-768s1c1
Sequence:CCGGGAGAAGTTGACTCACTCCCAACTCGAGTTGGGAGTGAGTCAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172514.1-1203s1c1
Sequence:CCGGGTGCTAGATTTGACAGCACTTCTCGAGAAGTGCTGTCAAATCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172514.1-658s1c1
Sequence:CCGGCAAGGAGAACTTAGTTAGAATCTCGAGATTCTAACTAAGTTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-1629s21c1
Sequence:CCGGACAATGCAAACAAGCTTATTACTCGAGTAATAAGCTTGTTTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-767s21c1
Sequence:CCGGGAGAAGTTGACTCACTCCCAACTCGAGTTGGGAGTGAGTCAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-657s21c1
Sequence:CCGGCAAGGAGAACTTAGTTAGAATCTCGAGATTCTAACTAAGTTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-392s21c1
Sequence:CCGGCAGTAGCAAATGACTCCAGGTCTCGAGACCTGGAGTCATTTGCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-1390s21c1
Sequence:CCGGTCATTGGTTCAGGACAATAATCTCGAGATTATTGTCCTGAACCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172514
VALIDATED
TMEM71 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 71
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172514.1-393s1c1
Sequence:CCGGCAGTAGCAAATGACTCCAGGTCTCGAGACCTGGAGTCATTTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172514.1-768s1c1
Sequence:CCGGGAGAAGTTGACTCACTCCCAACTCGAGTTGGGAGTGAGTCAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172514.1-1203s1c1
Sequence:CCGGGTGCTAGATTTGACAGCACTTCTCGAGAAGTGCTGTCAAATCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172514.1-658s1c1
Sequence:CCGGCAAGGAGAACTTAGTTAGAATCTCGAGATTCTAACTAAGTTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-1629s21c1
Sequence:CCGGACAATGCAAACAAGCTTATTACTCGAGTAATAAGCTTGTTTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-767s21c1
Sequence:CCGGGAGAAGTTGACTCACTCCCAACTCGAGTTGGGAGTGAGTCAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-657s21c1
Sequence:CCGGCAAGGAGAACTTAGTTAGAATCTCGAGATTCTAACTAAGTTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-392s21c1
Sequence:CCGGCAGTAGCAAATGACTCCAGGTCTCGAGACCTGGAGTCATTTGCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-1390s21c1
Sequence:CCGGTCATTGGTTCAGGACAATAATCTCGAGATTATTGTCCTGAACCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172514
VALIDATED
TMEM71 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 71
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172514.1-393s1c1
Sequence:CCGGCAGTAGCAAATGACTCCAGGTCTCGAGACCTGGAGTCATTTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172514.1-768s1c1
Sequence:CCGGGAGAAGTTGACTCACTCCCAACTCGAGTTGGGAGTGAGTCAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172514.1-1203s1c1
Sequence:CCGGGTGCTAGATTTGACAGCACTTCTCGAGAAGTGCTGTCAAATCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172514.1-658s1c1
Sequence:CCGGCAAGGAGAACTTAGTTAGAATCTCGAGATTCTAACTAAGTTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-1629s21c1
Sequence:CCGGACAATGCAAACAAGCTTATTACTCGAGTAATAAGCTTGTTTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-767s21c1
Sequence:CCGGGAGAAGTTGACTCACTCCCAACTCGAGTTGGGAGTGAGTCAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-657s21c1
Sequence:CCGGCAAGGAGAACTTAGTTAGAATCTCGAGATTCTAACTAAGTTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-392s21c1
Sequence:CCGGCAGTAGCAAATGACTCCAGGTCTCGAGACCTGGAGTCATTTGCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172514.3-1390s21c1
Sequence:CCGGTCATTGGTTCAGGACAATAATCTCGAGATTATTGTCCTGAACCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144649
TMEM71 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 71
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144649.1-427s1c1
Sequence:CCGGCCAGCGTTATGTATAAGGAGACTCGAGTCTCCTTATACATAACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144649.1-344s1c1
Sequence:CCGGCCTCACCAATGGCTACTATATCTCGAGATATAGTAGCCATTGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144649.1-880s1c1
Sequence:CCGGCATTGATGATAACTGTAGCTTCTCGAGAAGCTACAGTTATCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144649.1-1424s1c1
Sequence:CCGGCCTGACAACTTGAATAACAATCTCGAGATTGTTATTCAAGTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144649.2-558s21c1
Sequence:CCGGGGCTGCATGGAAGTATCTTTGCTCGAGCAAAGATACTTCCATGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144649.2-462s21c1
Sequence:CCGCACAGCTTCCTGTGCGACAAAGCTCGAGCTTTGTCGCACAGGAAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144649.2-1069s21c1
Sequence:CCGGTAGGAATGCCTTCGATGAATGCTCGAGCATTCATCGAAGGCATTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144649.2-1153s21c1
Sequence:CCGGGGAAGGGAGTAAGCGAGTAATCTCGAGATTACTCGCTTACTCCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144649
TMEM71 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 71
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144649.1-427s1c1
Sequence:CCGGCCAGCGTTATGTATAAGGAGACTCGAGTCTCCTTATACATAACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144649.1-344s1c1
Sequence:CCGGCCTCACCAATGGCTACTATATCTCGAGATATAGTAGCCATTGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144649.1-880s1c1
Sequence:CCGGCATTGATGATAACTGTAGCTTCTCGAGAAGCTACAGTTATCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144649.1-1424s1c1
Sequence:CCGGCCTGACAACTTGAATAACAATCTCGAGATTGTTATTCAAGTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144649.2-558s21c1
Sequence:CCGGGGCTGCATGGAAGTATCTTTGCTCGAGCAAAGATACTTCCATGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144649.2-462s21c1
Sequence:CCGCACAGCTTCCTGTGCGACAAAGCTCGAGCTTTGTCGCACAGGAAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144649.2-1069s21c1
Sequence:CCGGTAGGAATGCCTTCGATGAATGCTCGAGCATTCATCGAAGGCATTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144649.2-1153s21c1
Sequence:CCGGGGAAGGGAGTAAGCGAGTAATCTCGAGATTACTCGCTTACTCCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144649
TMEM71 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 71
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144649.1-427s1c1
Sequence:CCGGCCAGCGTTATGTATAAGGAGACTCGAGTCTCCTTATACATAACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144649.1-344s1c1
Sequence:CCGGCCTCACCAATGGCTACTATATCTCGAGATATAGTAGCCATTGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144649.1-880s1c1
Sequence:CCGGCATTGATGATAACTGTAGCTTCTCGAGAAGCTACAGTTATCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144649.1-1424s1c1
Sequence:CCGGCCTGACAACTTGAATAACAATCTCGAGATTGTTATTCAAGTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144649.2-558s21c1
Sequence:CCGGGGCTGCATGGAAGTATCTTTGCTCGAGCAAAGATACTTCCATGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144649.2-462s21c1
Sequence:CCGCACAGCTTCCTGTGCGACAAAGCTCGAGCTTTGTCGCACAGGAAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144649.2-1069s21c1
Sequence:CCGGTAGGAATGCCTTCGATGAATGCTCGAGCATTCATCGAAGGCATTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144649.2-1153s21c1
Sequence:CCGGGGAAGGGAGTAAGCGAGTAATCTCGAGATTACTCGCTTACTCCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks