EMAIL THIS PAGE TO A FRIEND

TMEM72

transmembrane protein 72

Synonyms: C10orf127 KSP37 bA285G1.3
UniProtKB ID: A0PK05, A1L181, Q5T740
Gene ID:
Mouse(319776) transmembrane protein 72
Rat(362424) transmembrane protein 72
cow(513137) transmembrane protein 72
sheep(101118414) transmembrane protein 72
domestic guinea pig(100735076) transmembrane protein 72
Zebrafish(562321) transmembrane protein 72
dog(100684938) transmembrane protein 72
domestic cat(101099248) transmembrane protein 72
chicken(100859699) transmembrane protein 72
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123376 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001031 MISSION® esiRNA esiRNA targeting human TMEM72 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123376 Rosetta Predictions human pricing
XM_926597 Rosetta Predictions human pricing
NM_001108643 Rosetta Predictions rat pricing
NM_178768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327836 predicted 320
2 SASI_Hs02_00327837 predicted 315
3 SASI_Hs02_00327838 predicted 678
4 SASI_Hs02_00327839 predicted 260
5 SASI_Hs02_00327840 predicted 849
6 SASI_Hs02_00327841 predicted 367
7 SASI_Hs02_00327842 predicted 839
8 SASI_Hs02_00327843 predicted 291
9 SASI_Hs02_00327844 predicted 202
10 SASI_Hs02_00327845 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253077 predicted 377
2 SASI_Hs01_00253078 predicted 492
3 SASI_Hs01_00253079 predicted 374
4 SASI_Hs01_00253080 predicted 378
5 SASI_Hs01_00253081 predicted 386
6 SASI_Hs01_00253082 predicted 794
7 SASI_Hs01_00253083 predicted 742
8 SASI_Hs01_00253084 predicted 640
9 SASI_Hs01_00253085 predicted 708
10 SASI_Hs01_00253086 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240649 predicted 1038
2 SASI_Rn02_00240650 predicted 504
3 SASI_Rn02_00240651 predicted 1654
4 SASI_Rn02_00240652 predicted 1013
5 SASI_Rn02_00240653 predicted 1206
6 SASI_Rn02_00240654 predicted 1439
7 SASI_Rn02_00240655 predicted 359
8 SASI_Rn02_00240656 predicted 1368
9 SASI_Rn02_00240657 predicted 1586
10 SASI_Rn02_00240658 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069682 predicted 1491
2 SASI_Mm01_00069683 predicted 353
3 SASI_Mm01_00069684 predicted 1404
4 SASI_Mm01_00069685 predicted 1186
5 SASI_Mm01_00069686 predicted 921
6 SASI_Mm01_00069687 predicted 879
7 SASI_Mm01_00069688 predicted 850
8 SASI_Mm01_00069689 predicted 1423
9 SASI_Mm01_00069690 predicted 336
10 SASI_Mm01_00069691 predicted 1198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123376
TMEM72 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 72
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-320s21c1
Sequence:CCGGGGCTTTCTATCTGCTGTTTACCTCGAGGTAAACAGCAGATAGAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-581s21c1
Sequence:CCGGCCTTCTGAGCAAGCGGAAGAACTCGAGTTCTTCCGCTTGCTCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-900s21c1
Sequence:CCGGCTCGCTGAAGGTCTGGATGATCTCGAGATCATCCAGACCTTCAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-873s21c1
Sequence:CCGGGACAACTTGGTCCGCATAGTCCTCGAGGACTATGCGGACCAAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-690s21c1
Sequence:CCGGACAGAGCAAACCTACACTTTCCTCGAGGAAAGTGTAGGTTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123376
TMEM72 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 72
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-320s21c1
Sequence:CCGGGGCTTTCTATCTGCTGTTTACCTCGAGGTAAACAGCAGATAGAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-581s21c1
Sequence:CCGGCCTTCTGAGCAAGCGGAAGAACTCGAGTTCTTCCGCTTGCTCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-900s21c1
Sequence:CCGGCTCGCTGAAGGTCTGGATGATCTCGAGATCATCCAGACCTTCAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-873s21c1
Sequence:CCGGGACAACTTGGTCCGCATAGTCCTCGAGGACTATGCGGACCAAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-690s21c1
Sequence:CCGGACAGAGCAAACCTACACTTTCCTCGAGGAAAGTGTAGGTTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123376
TMEM72 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 72
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-320s21c1
Sequence:CCGGGGCTTTCTATCTGCTGTTTACCTCGAGGTAAACAGCAGATAGAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-581s21c1
Sequence:CCGGCCTTCTGAGCAAGCGGAAGAACTCGAGTTCTTCCGCTTGCTCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-900s21c1
Sequence:CCGGCTCGCTGAAGGTCTGGATGATCTCGAGATCATCCAGACCTTCAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-873s21c1
Sequence:CCGGGACAACTTGGTCCGCATAGTCCTCGAGGACTATGCGGACCAAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123376.1-690s21c1
Sequence:CCGGACAGAGCAAACCTACACTTTCCTCGAGGAAAGTGTAGGTTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178768
TMEM72 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 72
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178768.4-778s21c1
Sequence:CCGGGCAGACCCAAGATACCCTAATCTCGAGATTAGGGTATCTTGGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178768.4-523s21c1
Sequence:CCGGCATTCCAGGCTCCATGTTAATCTCGAGATTAACATGGAGCCTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178768.4-342s21c1
Sequence:CCGGTGTGTGAAGGGACCTACTTTGCTCGAGCAAAGTAGGTCCCTTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178768.4-240s21c1
Sequence:CCGGCTACGGCTGCAGTGTTGATTGCTCGAGCAATCAACACTGCAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178768.4-1172s21c1
Sequence:CCGGGACCTCCAGCAAGGTACAAATCTCGAGATTTGTACCTTGCTGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178768.3-779s1c1
Sequence:CCGGGCAGACCCAAGATACCCTAATCTCGAGATTAGGGTATCTTGGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178768.3-903s1c1
Sequence:CCGGGATAGTGACAGTGAACCAGAACTCGAGTTCTGGTTCACTGTCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178768.3-680s1c1
Sequence:CCGGGCAAACCTATACTTTCCATGACTCGAGTCATGGAAAGTATAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178768
TMEM72 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 72
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178768.4-778s21c1
Sequence:CCGGGCAGACCCAAGATACCCTAATCTCGAGATTAGGGTATCTTGGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178768.4-523s21c1
Sequence:CCGGCATTCCAGGCTCCATGTTAATCTCGAGATTAACATGGAGCCTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178768.4-342s21c1
Sequence:CCGGTGTGTGAAGGGACCTACTTTGCTCGAGCAAAGTAGGTCCCTTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178768.4-240s21c1
Sequence:CCGGCTACGGCTGCAGTGTTGATTGCTCGAGCAATCAACACTGCAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178768.4-1172s21c1
Sequence:CCGGGACCTCCAGCAAGGTACAAATCTCGAGATTTGTACCTTGCTGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178768.3-779s1c1
Sequence:CCGGGCAGACCCAAGATACCCTAATCTCGAGATTAGGGTATCTTGGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178768.3-903s1c1
Sequence:CCGGGATAGTGACAGTGAACCAGAACTCGAGTTCTGGTTCACTGTCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178768.3-680s1c1
Sequence:CCGGGCAAACCTATACTTTCCATGACTCGAGTCATGGAAAGTATAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178768
TMEM72 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 72
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178768.4-778s21c1
Sequence:CCGGGCAGACCCAAGATACCCTAATCTCGAGATTAGGGTATCTTGGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178768.4-523s21c1
Sequence:CCGGCATTCCAGGCTCCATGTTAATCTCGAGATTAACATGGAGCCTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178768.4-342s21c1
Sequence:CCGGTGTGTGAAGGGACCTACTTTGCTCGAGCAAAGTAGGTCCCTTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178768.4-240s21c1
Sequence:CCGGCTACGGCTGCAGTGTTGATTGCTCGAGCAATCAACACTGCAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178768.4-1172s21c1
Sequence:CCGGGACCTCCAGCAAGGTACAAATCTCGAGATTTGTACCTTGCTGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178768.3-779s1c1
Sequence:CCGGGCAGACCCAAGATACCCTAATCTCGAGATTAGGGTATCTTGGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178768.3-903s1c1
Sequence:CCGGGATAGTGACAGTGAACCAGAACTCGAGTTCTGGTTCACTGTCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178768.3-680s1c1
Sequence:CCGGGCAAACCTATACTTTCCATGACTCGAGTCATGGAAAGTATAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks