EMAIL THIS PAGE TO A FRIEND

TMEM74

transmembrane protein 74

Synonyms: NET36
UniProtKB ID: Q96NL1
Gene ID:
Mouse(239408) transmembrane protein 74
Rat(500864) transmembrane protein 74
domestic cat(101088141) transmembrane protein 74
domestic guinea pig(100735988) transmembrane protein 74
cow(539995) transmembrane protein 74
sheep(101118621) transmembrane protein 74
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015672 Anti-TMEM74 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2103292 Anti-TMEM74 antibody produced in rabbit affinity isolated antibody canine, horse, rat, mouse, guinea pig, rabbit, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153015 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047211 MISSION® esiRNA esiRNA human TMEM74 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153015 Rosetta Predictions human pricing
XM_001063530 Rosetta Predictions rat pricing
XM_576263 Rosetta Predictions rat pricing
NM_175502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175554 predicted 830
2 SASI_Hs02_00366971 predicted 259
3 SASI_Hs01_00175556 predicted 355
4 SASI_Hs02_00366972 predicted 581
5 SASI_Hs01_00175557 predicted 656
6 SASI_Hs01_00175558 predicted 413
7 SASI_Hs01_00175559 predicted 1364
8 SASI_Hs02_00366973 predicted 660
9 SASI_Hs01_00175560 predicted 1295
10 SASI_Hs01_00175561 predicted 544
11 SASI_Hs01_00175555 predicted 266
12 SASI_Hs01_00175562 predicted 1375
13 SASI_Hs01_00175563 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307452 predicted 691
2 SASI_Rn02_00307453 predicted 1093
3 SASI_Rn02_00307454 predicted 1056
4 SASI_Rn02_00307455 predicted 732
5 SASI_Rn02_00307456 predicted 1248
6 SASI_Rn02_00307457 predicted 965
7 SASI_Rn02_00307458 predicted 588
8 SASI_Rn02_00307459 predicted 796
9 SASI_Rn02_00307460 predicted 808
10 SASI_Rn02_00307461 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404963 predicted 690
2 SASI_Rn02_00404964 predicted 1094
3 SASI_Rn02_00404965 predicted 1062
4 SASI_Rn02_00404966 predicted 732
5 SASI_Rn02_00404967 predicted 1243
6 SASI_Rn02_00404968 predicted 957
7 SASI_Rn02_00404969 predicted 597
8 SASI_Rn02_00404970 predicted 790
9 SASI_Rn02_00404971 predicted 804
10 SASI_Rn02_00404972 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168682 predicted 906
2 SASI_Mm02_00346415 predicted 587
3 SASI_Mm01_00168683 predicted 735
4 SASI_Mm01_00168684 predicted 1076
5 SASI_Mm01_00168685 predicted 1239
6 SASI_Mm01_00168688 predicted 1057
7 SASI_Mm01_00168689 predicted 942
8 SASI_Mm02_00346416 predicted 916
9 SASI_Mm01_00168690 predicted 746
10 SASI_Mm01_00168691 predicted 786
11 SASI_Mm01_00168686 predicted 1003
12 SASI_Mm01_00168687 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175502
VALIDATED
TMEM74 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 74
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175502.2-783s1c1
Sequence:CCGGCTCAGGGAACAACCAAGTAATCTCGAGATTACTTGGTTGTTCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175502.2-992s1c1
Sequence:CCGGCGGAAGACGATGATGATACAACTCGAGTTGTATCATCATCGTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175502.2-781s1c1
Sequence:CCGGGACTCAGGGAACAACCAAGTACTCGAGTACTTGGTTGTTCCCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175502.2-593s1c1
Sequence:CCGGGAGAGACTTCTGGTGACCATACTCGAGTATGGTCACCAGAAGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175502
VALIDATED
TMEM74 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 74
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175502.2-783s1c1
Sequence:CCGGCTCAGGGAACAACCAAGTAATCTCGAGATTACTTGGTTGTTCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175502.2-992s1c1
Sequence:CCGGCGGAAGACGATGATGATACAACTCGAGTTGTATCATCATCGTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175502.2-781s1c1
Sequence:CCGGGACTCAGGGAACAACCAAGTACTCGAGTACTTGGTTGTTCCCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175502.2-593s1c1
Sequence:CCGGGAGAGACTTCTGGTGACCATACTCGAGTATGGTCACCAGAAGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175502
VALIDATED
TMEM74 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 74
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175502.2-783s1c1
Sequence:CCGGCTCAGGGAACAACCAAGTAATCTCGAGATTACTTGGTTGTTCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175502.2-992s1c1
Sequence:CCGGCGGAAGACGATGATGATACAACTCGAGTTGTATCATCATCGTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175502.2-781s1c1
Sequence:CCGGGACTCAGGGAACAACCAAGTACTCGAGTACTTGGTTGTTCCCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175502.2-593s1c1
Sequence:CCGGGAGAGACTTCTGGTGACCATACTCGAGTATGGTCACCAGAAGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153015
TMEM74 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 74
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153015.1-593s1c1
Sequence:CCGGCAAGTTCAGAAGCCACGTCTTCTCGAGAAGACGTGGCTTCTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130463    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153015.1-1792s1c1
Sequence:CCGGGCCATCATACTGGTTATCTGTCTCGAGACAGATAACCAGTATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153015.1-848s1c1
Sequence:CCGGGCTTGTTAATGATGTCCATGTCTCGAGACATGGACATCATTAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153015.1-675s1c1
Sequence:CCGGGCTCGTGATCATCTCTTACATCTCGAGATGTAAGAGATGATCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153015.1-1271s1c1
Sequence:CCGGGCCAAGAACTTCTACTTCGATCTCGAGATCGAAGTAGAAGTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153015.1-1374s1c1
Sequence:CCGGCCTACACACAGTAGGATCAATCTCGAGATTGATCCTACTGTGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153015.1-1931s1c1
Sequence:CCGGGCTTCCAGGTAACATCTTGTTCTCGAGAACAAGATGTTACCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153015
TMEM74 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 74
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153015.1-593s1c1
Sequence:CCGGCAAGTTCAGAAGCCACGTCTTCTCGAGAAGACGTGGCTTCTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130463    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153015.1-1792s1c1
Sequence:CCGGGCCATCATACTGGTTATCTGTCTCGAGACAGATAACCAGTATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153015.1-848s1c1
Sequence:CCGGGCTTGTTAATGATGTCCATGTCTCGAGACATGGACATCATTAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153015.1-675s1c1
Sequence:CCGGGCTCGTGATCATCTCTTACATCTCGAGATGTAAGAGATGATCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153015.1-1271s1c1
Sequence:CCGGGCCAAGAACTTCTACTTCGATCTCGAGATCGAAGTAGAAGTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153015.1-1374s1c1
Sequence:CCGGCCTACACACAGTAGGATCAATCTCGAGATTGATCCTACTGTGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153015.1-1931s1c1
Sequence:CCGGGCTTCCAGGTAACATCTTGTTCTCGAGAACAAGATGTTACCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153015
TMEM74 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 74
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153015.1-593s1c1
Sequence:CCGGCAAGTTCAGAAGCCACGTCTTCTCGAGAAGACGTGGCTTCTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130463    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153015.1-1792s1c1
Sequence:CCGGGCCATCATACTGGTTATCTGTCTCGAGACAGATAACCAGTATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153015.1-848s1c1
Sequence:CCGGGCTTGTTAATGATGTCCATGTCTCGAGACATGGACATCATTAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153015.1-675s1c1
Sequence:CCGGGCTCGTGATCATCTCTTACATCTCGAGATGTAAGAGATGATCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153015.1-1271s1c1
Sequence:CCGGGCCAAGAACTTCTACTTCGATCTCGAGATCGAAGTAGAAGTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153015.1-1374s1c1
Sequence:CCGGCCTACACACAGTAGGATCAATCTCGAGATTGATCCTACTGTGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153015.1-1931s1c1
Sequence:CCGGGCTTCCAGGTAACATCTTGTTCTCGAGAACAAGATGTTACCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks