EMAIL THIS PAGE TO A FRIEND

TMEM74B

transmembrane protein 74B

Synonyms: C20orf46
UniProtKB ID: Q9NUR3, D3DVW5
Gene ID:
Mouse(108832) transmembrane protein 74b
Rat(499917) transmembrane protein 74B
cow(539523) transmembrane protein 74B
sheep(101106959) transmembrane protein 74B
domestic guinea pig(100715630) transmembrane protein 74B
naked mole-rat(101700125) transmembrane protein 74B
dog(609575) transmembrane protein 74B
domestic cat(101087053) transmembrane protein 74B
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018354 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001160363 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001160363 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001160363 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018354 Rosetta Predictions human pricing
XM_001060786 Rosetta Predictions rat pricing
XM_575260 Rosetta Predictions rat pricing
XM_130642 Rosetta Predictions mouse pricing
XM_904586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075832 predicted 965
2 SASI_Hs01_00075833 predicted 1025
3 SASI_Hs01_00075834 predicted 1061
4 SASI_Hs01_00075836 predicted 1107
5 SASI_Hs01_00075837 predicted 958
6 SASI_Hs01_00075838 predicted 1018
7 SASI_Hs01_00075839 predicted 1448
8 SASI_Hs01_00075840 predicted 1333
9 SASI_Hs01_00075841 predicted 1315
10 SASI_Hs02_00351812 predicted 1158
11 SASI_Hs01_00075835 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297711 predicted 929
2 SASI_Rn02_00297712 predicted 1038
3 SASI_Rn02_00297713 predicted 1194
4 SASI_Rn02_00297714 predicted 990
5 SASI_Rn02_00297715 predicted 519
6 SASI_Rn02_00297716 predicted 903
7 SASI_Rn02_00297717 predicted 1146
8 SASI_Rn02_00297718 predicted 562
9 SASI_Rn02_00297719 predicted 461
10 SASI_Rn02_00297720 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403390 predicted 929
2 SASI_Rn02_00403391 predicted 1033
3 SASI_Rn02_00403392 predicted 1199
4 SASI_Rn02_00403393 predicted 988
5 SASI_Rn02_00403394 predicted 518
6 SASI_Rn02_00403395 predicted 894
7 SASI_Rn02_00403396 predicted 1148
8 SASI_Rn02_00403397 predicted 559
9 SASI_Rn02_00403398 predicted 461
10 SASI_Rn02_00403399 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130642 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256976 predicted 915
2 SASI_Mm01_00256977 predicted 532
3 SASI_Mm01_00256978 predicted 578
4 SASI_Mm01_00256979 predicted 478
5 SASI_Mm01_00256980 predicted 76
6 SASI_Mm01_00256981 predicted 1033
7 SASI_Mm01_00256982 predicted 65
8 SASI_Mm01_00256983 predicted 362
9 SASI_Mm02_00424373 predicted 738
10 SASI_Mm01_00256984 predicted 1026
11 SASI_Mm01_00256985 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430993 predicted 856
2 SASI_Mm02_00430994 predicted 531
3 SASI_Mm02_00430995 predicted 627
4 SASI_Mm02_00430996 predicted 577
5 SASI_Mm02_00430997 predicted 482
6 SASI_Mm02_00430998 predicted 478
7 SASI_Mm02_00430999 predicted 894
8 SASI_Mm02_00431000 predicted 696
9 SASI_Mm02_00431001 predicted 521
10 SASI_Mm02_00431002 predicted 787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018354
VALIDATED
TMEM74B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 74B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-769s1c1
Sequence:CCGGCTGAAGACACTGAGCAATGGTCTCGAGACCATTGCTCAGTGTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-761s1c1
Sequence:CCGGGTCTGGAACTGAAGACACTGACTCGAGTCAGTGTCTTCAGTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-766s1c1
Sequence:CCGGGAACTGAAGACACTGAGCAATCTCGAGATTGCTCAGTGTCTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018354.1-970s1c1
Sequence:CCGGGATGATCTGTCCCTTCATTCACTCGAGTGAATGAAGGGACAGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-876s1c1
Sequence:CCGGGCATGAGACCCATTTCCAGAACTCGAGTTCTGGAAATGGGTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-1024s1c1
Sequence:CCGGCCGGTGGATTATGGCTTTGTTCTCGAGAACAAAGCCATAATCCACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018354.1-1146s1c1
Sequence:CCGGGATGGAACGACTGGAGATGTACTCGAGTACATCTCCAGTCGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-1390s1c1
Sequence:CCGGGAGAATGAAGTTGTCCAGGTCCTCGAGGACCTGGACAACTTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018354.1-871s21c1
Sequence:CCGGGAGGAGCATGAGACCCATTTCCTCGAGGAAATGGGTCTCATGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018354.1-1323s21c1
Sequence:CCGGGAAGACCTACGGCTCCATTAACTCGAGTTAATGGAGCCGTAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018354.1-1424s21c1
Sequence:CCGGACACCCTCCAGAGGTCTTAAGCTCGAGCTTAAGACCTCTGGAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018354
VALIDATED
TMEM74B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 74B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-769s1c1
Sequence:CCGGCTGAAGACACTGAGCAATGGTCTCGAGACCATTGCTCAGTGTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-761s1c1
Sequence:CCGGGTCTGGAACTGAAGACACTGACTCGAGTCAGTGTCTTCAGTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-766s1c1
Sequence:CCGGGAACTGAAGACACTGAGCAATCTCGAGATTGCTCAGTGTCTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018354.1-970s1c1
Sequence:CCGGGATGATCTGTCCCTTCATTCACTCGAGTGAATGAAGGGACAGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-876s1c1
Sequence:CCGGGCATGAGACCCATTTCCAGAACTCGAGTTCTGGAAATGGGTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-1024s1c1
Sequence:CCGGCCGGTGGATTATGGCTTTGTTCTCGAGAACAAAGCCATAATCCACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018354.1-1146s1c1
Sequence:CCGGGATGGAACGACTGGAGATGTACTCGAGTACATCTCCAGTCGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-1390s1c1
Sequence:CCGGGAGAATGAAGTTGTCCAGGTCCTCGAGGACCTGGACAACTTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018354.1-871s21c1
Sequence:CCGGGAGGAGCATGAGACCCATTTCCTCGAGGAAATGGGTCTCATGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018354.1-1323s21c1
Sequence:CCGGGAAGACCTACGGCTCCATTAACTCGAGTTAATGGAGCCGTAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018354.1-1424s21c1
Sequence:CCGGACACCCTCCAGAGGTCTTAAGCTCGAGCTTAAGACCTCTGGAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018354
VALIDATED
TMEM74B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 74B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-769s1c1
Sequence:CCGGCTGAAGACACTGAGCAATGGTCTCGAGACCATTGCTCAGTGTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-761s1c1
Sequence:CCGGGTCTGGAACTGAAGACACTGACTCGAGTCAGTGTCTTCAGTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-766s1c1
Sequence:CCGGGAACTGAAGACACTGAGCAATCTCGAGATTGCTCAGTGTCTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018354.1-970s1c1
Sequence:CCGGGATGATCTGTCCCTTCATTCACTCGAGTGAATGAAGGGACAGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-876s1c1
Sequence:CCGGGCATGAGACCCATTTCCAGAACTCGAGTTCTGGAAATGGGTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-1024s1c1
Sequence:CCGGCCGGTGGATTATGGCTTTGTTCTCGAGAACAAAGCCATAATCCACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018354.1-1146s1c1
Sequence:CCGGGATGGAACGACTGGAGATGTACTCGAGTACATCTCCAGTCGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018354.1-1390s1c1
Sequence:CCGGGAGAATGAAGTTGTCCAGGTCCTCGAGGACCTGGACAACTTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018354.1-871s21c1
Sequence:CCGGGAGGAGCATGAGACCCATTTCCTCGAGGAAATGGGTCTCATGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018354.1-1323s21c1
Sequence:CCGGGAAGACCTACGGCTCCATTAACTCGAGTTAATGGAGCCGTAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018354.1-1424s21c1
Sequence:CCGGACACCCTCCAGAGGTCTTAAGCTCGAGCTTAAGACCTCTGGAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001160363
TMEM74B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 74B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160363.1-1254s21c1
Sequence:CCGGACCCATGGAGGGCATTGTAGACTCGAGTCTACAATGCCCTCCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160363.1-605s21c1
Sequence:CCGGTGAGGAGCAGGAGACTCATTTCTCGAGAAATGAGTCTCCTGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160363.1-1142s21c1
Sequence:CCGGAGTCTCAGAGACCAGCTATACCTCGAGGTATAGCTGGTCTCTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160363.1-1111s21c1
Sequence:CCGGGCCAGGTCCTAGTAGAGAATGCTCGAGCATTCTCTACTAGGACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160363.1-922s21c1
Sequence:CCGGATCTGGACAAATGCATCATTGCTCGAGCAATGATGCATTTGTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001160363
TMEM74B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 74B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160363.1-1254s21c1
Sequence:CCGGACCCATGGAGGGCATTGTAGACTCGAGTCTACAATGCCCTCCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160363.1-605s21c1
Sequence:CCGGTGAGGAGCAGGAGACTCATTTCTCGAGAAATGAGTCTCCTGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160363.1-1142s21c1
Sequence:CCGGAGTCTCAGAGACCAGCTATACCTCGAGGTATAGCTGGTCTCTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160363.1-1111s21c1
Sequence:CCGGGCCAGGTCCTAGTAGAGAATGCTCGAGCATTCTCTACTAGGACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160363.1-922s21c1
Sequence:CCGGATCTGGACAAATGCATCATTGCTCGAGCAATGATGCATTTGTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001160363
TMEM74B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 74B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160363.1-1254s21c1
Sequence:CCGGACCCATGGAGGGCATTGTAGACTCGAGTCTACAATGCCCTCCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160363.1-605s21c1
Sequence:CCGGTGAGGAGCAGGAGACTCATTTCTCGAGAAATGAGTCTCCTGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160363.1-1142s21c1
Sequence:CCGGAGTCTCAGAGACCAGCTATACCTCGAGGTATAGCTGGTCTCTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160363.1-1111s21c1
Sequence:CCGGGCCAGGTCCTAGTAGAGAATGCTCGAGCATTCTCTACTAGGACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160363.1-922s21c1
Sequence:CCGGATCTGGACAAATGCATCATTGCTCGAGCAATGATGCATTTGTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks