EMAIL THIS PAGE TO A FRIEND

TMEM79

transmembrane protein 79

UniProtKB ID: Q9BSE2, B2RE22, D3DVB8
Gene ID:
Mouse(71913) transmembrane protein 79
Rat(310626) transmembrane protein 79
chicken(426758) transmembrane protein 79
domestic cat(101085177) transmembrane protein 79
Horse(100057797) transmembrane protein 79
dog(612144) transmembrane protein 79
naked mole-rat(101709520) transmembrane protein 79
domestic guinea pig(100722654) transmembrane protein 79
cow(513599) transmembrane protein 79
sheep(101103024) transmembrane protein 79
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032323 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032323 Rosetta Predictions human pricing
NM_001033896 Rosetta Predictions rat pricing
NM_024246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225146 predicted 1842
2 SASI_Hs01_00225147 predicted 810
3 SASI_Hs01_00225150 predicted 539
4 SASI_Hs01_00225151 predicted 843
5 SASI_Hs01_00225152 predicted 351
6 SASI_Hs02_00359688 predicted 236
7 SASI_Hs02_00359689 predicted 344
8 SASI_Hs02_00359690 predicted 1018
9 SASI_Hs02_00359691 predicted 546
10 SASI_Hs02_00359692 predicted 807
11 SASI_Hs01_00225145 predicted 1754
12 SASI_Hs01_00225148 predicted 1543
13 SASI_Hs01_00225149 predicted 1804
14 SASI_Hs01_00225153 predicted 1832
15 SASI_Hs01_00225154 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047982 predicted 1753
2 SASI_Rn01_00047984 predicted 1159
3 SASI_Rn01_00047985 predicted 1612
4 SASI_Rn01_00047986 predicted 1571
5 SASI_Rn01_00047987 predicted 1456
6 SASI_Rn01_00047988 predicted 1757
7 SASI_Rn01_00047989 predicted 347
8 SASI_Rn01_00047990 predicted 665
9 SASI_Rn02_00203794 predicted 1753
10 SASI_Rn02_00203795 predicted 1540
11 SASI_Rn01_00047981 predicted 1416
12 SASI_Rn01_00047983 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327626 predicted 228
2 SASI_Mm01_00159567 predicted 1038
3 SASI_Mm01_00159568 predicted 825
4 SASI_Mm01_00159570 predicted 1632
5 SASI_Mm01_00159571 predicted 1641
6 SASI_Mm01_00159572 predicted 415
7 SASI_Mm01_00159573 predicted 1646
8 SASI_Mm01_00159574 predicted 1633
9 SASI_Mm01_00159575 predicted 401
10 SASI_Mm01_00159576 predicted 550
11 SASI_Mm01_00159569 predicted 813
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024246
TMEM79 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 79
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024246.3-277s1c1
Sequence:CCGGGATGGTCCAGACAGCACAATACTCGAGTATTGTGCTGTCTGGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024246.3-964s1c1
Sequence:CCGGCTCTACTTCTTTAACCTGGCTCTCGAGAGCCAGGTTAAAGAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024246.5-1141s21c1
Sequence:CCGGTGCTGGTGTGGAACCTCTATTCTCGAGAATAGAGGTTCCACACCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024246.5-393s21c1
Sequence:CCGGGAGTCAGAGGCACCTACTAAGCTCGAGCTTAGTAGGTGCCTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024246.5-1913s21c1
Sequence:CCGGATAGCTGTGAGTATGTAATAACTCGAGTTATTACATACTCACAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024246.5-276s21c1
Sequence:CCGGGATGGTCCAGACAGCACAATACTCGAGTATTGTGCTGTCTGGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024246.5-1034s21c1
Sequence:CCGGCACCGGTCTCTTTGCCATATCCTCGAGGATATGGCAAAGAGACCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024246
TMEM79 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 79
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024246.3-277s1c1
Sequence:CCGGGATGGTCCAGACAGCACAATACTCGAGTATTGTGCTGTCTGGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024246.3-964s1c1
Sequence:CCGGCTCTACTTCTTTAACCTGGCTCTCGAGAGCCAGGTTAAAGAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024246.5-1141s21c1
Sequence:CCGGTGCTGGTGTGGAACCTCTATTCTCGAGAATAGAGGTTCCACACCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024246.5-393s21c1
Sequence:CCGGGAGTCAGAGGCACCTACTAAGCTCGAGCTTAGTAGGTGCCTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024246.5-1913s21c1
Sequence:CCGGATAGCTGTGAGTATGTAATAACTCGAGTTATTACATACTCACAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024246.5-276s21c1
Sequence:CCGGGATGGTCCAGACAGCACAATACTCGAGTATTGTGCTGTCTGGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024246.5-1034s21c1
Sequence:CCGGCACCGGTCTCTTTGCCATATCCTCGAGGATATGGCAAAGAGACCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024246
TMEM79 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 79
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024246.3-277s1c1
Sequence:CCGGGATGGTCCAGACAGCACAATACTCGAGTATTGTGCTGTCTGGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024246.3-964s1c1
Sequence:CCGGCTCTACTTCTTTAACCTGGCTCTCGAGAGCCAGGTTAAAGAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024246.5-1141s21c1
Sequence:CCGGTGCTGGTGTGGAACCTCTATTCTCGAGAATAGAGGTTCCACACCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024246.5-393s21c1
Sequence:CCGGGAGTCAGAGGCACCTACTAAGCTCGAGCTTAGTAGGTGCCTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024246.5-1913s21c1
Sequence:CCGGATAGCTGTGAGTATGTAATAACTCGAGTTATTACATACTCACAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024246.5-276s21c1
Sequence:CCGGGATGGTCCAGACAGCACAATACTCGAGTATTGTGCTGTCTGGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024246.5-1034s21c1
Sequence:CCGGCACCGGTCTCTTTGCCATATCCTCGAGGATATGGCAAAGAGACCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032323
TMEM79 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 79
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000131126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032323.1-351s1c1
Sequence:CCGGGATGGTCTAGACAGCACAGTACTCGAGTACTGTGCTGTCTAGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032323.1-1220s1c1
Sequence:CCGGGATGTGGAACCTCTACTACATCTCGAGATGTAGTAGAGGTTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032323.1-1223s1c1
Sequence:CCGGGTGGAACCTCTACTACATGTTCTCGAGAACATGTAGTAGAGGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032323.1-552s1c1
Sequence:CCGGCCTATTGACCTACAGTGCATTCTCGAGAATGCACTGTAGGTCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032323
TMEM79 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 79
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000131126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032323.1-351s1c1
Sequence:CCGGGATGGTCTAGACAGCACAGTACTCGAGTACTGTGCTGTCTAGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032323.1-1220s1c1
Sequence:CCGGGATGTGGAACCTCTACTACATCTCGAGATGTAGTAGAGGTTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032323.1-1223s1c1
Sequence:CCGGGTGGAACCTCTACTACATGTTCTCGAGAACATGTAGTAGAGGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032323.1-552s1c1
Sequence:CCGGCCTATTGACCTACAGTGCATTCTCGAGAATGCACTGTAGGTCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032323
TMEM79 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 79
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000131126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032323.1-351s1c1
Sequence:CCGGGATGGTCTAGACAGCACAGTACTCGAGTACTGTGCTGTCTAGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032323.1-1220s1c1
Sequence:CCGGGATGTGGAACCTCTACTACATCTCGAGATGTAGTAGAGGTTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032323.1-1223s1c1
Sequence:CCGGGTGGAACCTCTACTACATGTTCTCGAGAACATGTAGTAGAGGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032323.1-552s1c1
Sequence:CCGGCCTATTGACCTACAGTGCATTCTCGAGAATGCACTGTAGGTCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks